Incidental Mutation 'R9318:Prkg1'
ID 706012
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Name protein kinase, cGMP-dependent, type I
Synonyms Prkgr1b, Prkg1b
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.524) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30567551-31765033 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30571638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 646 (T646S)
Ref Sequence ENSEMBL: ENSMUSP00000073268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
AlphaFold P0C605
Predicted Effect probably benign
Transcript: ENSMUST00000065067
AA Change: T631S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: T631S

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073581
AA Change: T646S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: T646S

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,403,440 S68P possibly damaging Het
Adcy6 A T 15: 98,593,585 N1044K possibly damaging Het
Ak9 T G 10: 41,423,085 M1594R unknown Het
Angpt1 A G 15: 42,438,355 I419T probably benign Het
Ankrd31 A T 13: 96,878,577 L1451F probably benign Het
Ap1b1 T C 11: 5,040,157 I860T probably benign Het
Apc G A 18: 34,313,987 R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,888 Y453H probably benign Het
Carmil2 A G 8: 105,687,854 T148A probably benign Het
Ccdc125 A G 13: 100,696,412 Y499C probably damaging Het
Ccdc14 A G 16: 34,704,918 M194V possibly damaging Het
Ccdc162 C A 10: 41,630,114 M893I probably benign Het
Ccdc33 C A 9: 58,086,593 W335L possibly damaging Het
Chn2 T A 6: 54,295,855 Y355N probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec4g A G 8: 3,716,500 M267T probably damaging Het
Clybl G A 14: 122,371,403 V136I probably damaging Het
Ctnnd1 G T 2: 84,608,338 Q877K probably benign Het
Derl3 A G 10: 75,894,014 K94R probably null Het
Dnah2 T C 11: 69,484,329 E1356G probably benign Het
Dnah5 A C 15: 28,203,908 probably benign Het
Dusp19 T A 2: 80,631,000 V211E probably benign Het
Entpd7 T A 19: 43,704,270 V88E possibly damaging Het
Fam114a1 T A 5: 64,995,884 S140T possibly damaging Het
Fbxw13 A G 9: 109,179,314 F456L probably benign Het
Fpr-rs4 A T 17: 18,021,955 M75L probably benign Het
Gm11639 T C 11: 104,965,822 probably null Het
Grb14 T G 2: 65,022,641 T2P probably damaging Het
Hace1 T A 10: 45,652,673 S337T probably benign Het
Heatr5b C T 17: 78,765,402 V1611I probably benign Het
Hist2h2be T C 3: 96,221,365 V67A probably benign Het
Ints6 A T 14: 62,696,698 S787T probably benign Het
Itga9 A G 9: 118,626,468 K70R probably benign Het
Kcnt2 T C 1: 140,425,195 I214T probably damaging Het
Kdelr3 C A 15: 79,527,074 L203I probably benign Het
Kpnb1 A G 11: 97,163,458 M842T probably benign Het
Lamc1 G T 1: 153,252,000 R386S probably damaging Het
Lctl A G 9: 64,119,257 probably benign Het
Lrrn3 G A 12: 41,453,244 P358L probably damaging Het
Mag T C 7: 30,900,368 H582R possibly damaging Het
Megf9 A T 4: 70,435,454 C372S probably damaging Het
Mfsd11 T C 11: 116,859,572 F139S probably damaging Het
Mpst G T 15: 78,410,442 V125L probably damaging Het
Myo15b T C 11: 115,885,139 V587A probably benign Het
Myod1 A T 7: 46,376,932 H87L probably damaging Het
Oacyl G T 18: 65,725,344 V247L probably benign Het
Olfr1116 A C 2: 87,268,927 T49P possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr177 A G 16: 58,872,385 L255P probably damaging Het
Olfr181 A T 16: 58,925,908 I221N probably damaging Het
Olfr350 G A 2: 36,850,553 C169Y probably benign Het
Olfr598 T A 7: 103,329,376 Y297N probably damaging Het
Olfr676 T C 7: 105,035,623 Y142H probably damaging Het
Olfr804 A G 10: 129,705,414 T179A probably benign Het
Olfr917 A G 9: 38,665,284 S187P possibly damaging Het
Olfr983 A C 9: 40,092,816 I50S possibly damaging Het
Pde3a T C 6: 141,479,476 F666S probably benign Het
Phf20 G A 2: 156,273,770 R337H probably benign Het
Plcg2 G A 8: 117,596,368 E721K probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss16 C A 13: 22,006,938 A206S possibly damaging Het
Prss37 A T 6: 40,514,975 Y224N probably damaging Het
Ptprt A G 2: 161,575,778 L926S probably benign Het
Rgl1 G A 1: 152,524,703 T649I possibly damaging Het
Rgs3 C A 4: 62,640,782 D504E probably benign Het
Rp1 C T 1: 4,348,265 A875T probably benign Het
Rpl9-ps1 T A 11: 83,645,351 K91* probably null Het
Slc44a2 A G 9: 21,341,972 Y65C probably damaging Het
Snw1 T C 12: 87,458,904 K255E probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Synpo2 A T 3: 123,080,056 I1146N probably damaging Het
Tas2r115 T C 6: 132,737,509 R160G probably benign Het
Tchh T C 3: 93,446,744 F1164L unknown Het
Tmem110 T A 14: 30,866,682 V122E probably damaging Het
Trim58 T C 11: 58,651,267 V351A probably damaging Het
Ttf1 T C 2: 29,074,654 S663P possibly damaging Het
Wdr59 A G 8: 111,451,068 Y920H Het
Zfp418 A G 7: 7,182,436 Y466C probably damaging Het
Zfp827 A T 8: 79,118,353 R717S possibly damaging Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31302340 missense probably benign 0.02
IGL00481:Prkg1 APN 19 30571622 missense probably benign 0.28
IGL00517:Prkg1 APN 19 30894668 missense probably benign
IGL00782:Prkg1 APN 19 30578753 splice site probably benign
IGL01070:Prkg1 APN 19 30569343 splice site probably benign
IGL01106:Prkg1 APN 19 30585278 missense probably benign 0.05
IGL01783:Prkg1 APN 19 30624689 missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30993076 missense probably benign 0.13
IGL02492:Prkg1 APN 19 30724202 missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30624734 missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31302301 missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30585281 nonsense probably null
IGL03220:Prkg1 APN 19 30569237 utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31664196 missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30594978 missense probably benign
R1099:Prkg1 UTSW 19 30571612 missense probably benign
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30624743 missense probably benign
R1738:Prkg1 UTSW 19 30786922 missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31585695 missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31664142 missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30578860 missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30578631 missense probably benign 0.27
R3009:Prkg1 UTSW 19 31664112 missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31585578 missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30569229 utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30595012 missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31664239 missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31664179 nonsense probably null
R4789:Prkg1 UTSW 19 31585645 missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31764606 missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30586375 missense probably benign 0.37
R5625:Prkg1 UTSW 19 31764762 missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31585672 missense probably benign 0.02
R5855:Prkg1 UTSW 19 30894694 missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31585697 missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30724156 splice site probably null
R5968:Prkg1 UTSW 19 30592924 missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30569251 missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30781346 missense probably benign 0.21
R6702:Prkg1 UTSW 19 30993084 missense probably benign 0.00
R6750:Prkg1 UTSW 19 31764561 missense probably benign 0.41
R6894:Prkg1 UTSW 19 30624774 nonsense probably null
R7155:Prkg1 UTSW 19 31302301 missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30585199 missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30624690 missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30578835 missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30993091 missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30578632 missense probably benign 0.00
R7804:Prkg1 UTSW 19 30624770 missense possibly damaging 0.92
R7893:Prkg1 UTSW 19 30586367 missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30724184 missense possibly damaging 0.75
R8497:Prkg1 UTSW 19 31302309 missense probably damaging 1.00
R8676:Prkg1 UTSW 19 31764746 missense probably damaging 0.98
R9694:Prkg1 UTSW 19 30786971 missense possibly damaging 0.84
X0011:Prkg1 UTSW 19 30993121 missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31302373 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCTAGACTTGTTGGTATCATGTTTG -3'
(R):5'- ATGGCAATAACTTACACATACAGAC -3'

Sequencing Primer
(F):5'- GTCATCTGATGGTAAAACTCTA -3'
(R):5'- ACATTCTGAGCCAGATGTGGTAGC -3'
Posted On 2022-03-25