Incidental Mutation 'R9318:Entpd7'
ID 706013
Institutional Source Beutler Lab
Gene Symbol Entpd7
Ensembl Gene ENSMUSG00000025192
Gene Name ectonucleoside triphosphate diphosphohydrolase 7
Synonyms 1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9318 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43689672-43733697 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43704270 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 88 (V88E)
Ref Sequence ENSEMBL: ENSMUSP00000079864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081079]
AlphaFold Q3TCT4
Predicted Effect possibly damaging
Transcript: ENSMUST00000081079
AA Change: V88E

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: V88E

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,403,440 S68P possibly damaging Het
Adcy6 A T 15: 98,593,585 N1044K possibly damaging Het
Ak9 T G 10: 41,423,085 M1594R unknown Het
Angpt1 A G 15: 42,438,355 I419T probably benign Het
Ankrd31 A T 13: 96,878,577 L1451F probably benign Het
Ap1b1 T C 11: 5,040,157 I860T probably benign Het
Apc G A 18: 34,313,987 R1312Q possibly damaging Het
Cadps2 A G 6: 23,496,888 Y453H probably benign Het
Carmil2 A G 8: 105,687,854 T148A probably benign Het
Ccdc125 A G 13: 100,696,412 Y499C probably damaging Het
Ccdc14 A G 16: 34,704,918 M194V possibly damaging Het
Ccdc162 C A 10: 41,630,114 M893I probably benign Het
Ccdc33 C A 9: 58,086,593 W335L possibly damaging Het
Chn2 T A 6: 54,295,855 Y355N probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Clec4g A G 8: 3,716,500 M267T probably damaging Het
Clybl G A 14: 122,371,403 V136I probably damaging Het
Ctnnd1 G T 2: 84,608,338 Q877K probably benign Het
Derl3 A G 10: 75,894,014 K94R probably null Het
Dnah2 T C 11: 69,484,329 E1356G probably benign Het
Dnah5 A C 15: 28,203,908 probably benign Het
Dusp19 T A 2: 80,631,000 V211E probably benign Het
Fam114a1 T A 5: 64,995,884 S140T possibly damaging Het
Fbxw13 A G 9: 109,179,314 F456L probably benign Het
Fpr-rs4 A T 17: 18,021,955 M75L probably benign Het
Gm11639 T C 11: 104,965,822 probably null Het
Grb14 T G 2: 65,022,641 T2P probably damaging Het
Hace1 T A 10: 45,652,673 S337T probably benign Het
Heatr5b C T 17: 78,765,402 V1611I probably benign Het
Hist2h2be T C 3: 96,221,365 V67A probably benign Het
Ints6 A T 14: 62,696,698 S787T probably benign Het
Itga9 A G 9: 118,626,468 K70R probably benign Het
Kcnt2 T C 1: 140,425,195 I214T probably damaging Het
Kdelr3 C A 15: 79,527,074 L203I probably benign Het
Kpnb1 A G 11: 97,163,458 M842T probably benign Het
Lamc1 G T 1: 153,252,000 R386S probably damaging Het
Lctl A G 9: 64,119,257 probably benign Het
Lrrn3 G A 12: 41,453,244 P358L probably damaging Het
Mag T C 7: 30,900,368 H582R possibly damaging Het
Megf9 A T 4: 70,435,454 C372S probably damaging Het
Mfsd11 T C 11: 116,859,572 F139S probably damaging Het
Mpst G T 15: 78,410,442 V125L probably damaging Het
Myo15b T C 11: 115,885,139 V587A probably benign Het
Myod1 A T 7: 46,376,932 H87L probably damaging Het
Oacyl G T 18: 65,725,344 V247L probably benign Het
Olfr1116 A C 2: 87,268,927 T49P possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr177 A G 16: 58,872,385 L255P probably damaging Het
Olfr181 A T 16: 58,925,908 I221N probably damaging Het
Olfr350 G A 2: 36,850,553 C169Y probably benign Het
Olfr598 T A 7: 103,329,376 Y297N probably damaging Het
Olfr676 T C 7: 105,035,623 Y142H probably damaging Het
Olfr804 A G 10: 129,705,414 T179A probably benign Het
Olfr917 A G 9: 38,665,284 S187P possibly damaging Het
Olfr983 A C 9: 40,092,816 I50S possibly damaging Het
Pde3a T C 6: 141,479,476 F666S probably benign Het
Phf20 G A 2: 156,273,770 R337H probably benign Het
Plcg2 G A 8: 117,596,368 E721K probably benign Het
Prkg1 T A 19: 30,571,638 T646S probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss16 C A 13: 22,006,938 A206S possibly damaging Het
Prss37 A T 6: 40,514,975 Y224N probably damaging Het
Ptprt A G 2: 161,575,778 L926S probably benign Het
Rgl1 G A 1: 152,524,703 T649I possibly damaging Het
Rgs3 C A 4: 62,640,782 D504E probably benign Het
Rp1 C T 1: 4,348,265 A875T probably benign Het
Rpl9-ps1 T A 11: 83,645,351 K91* probably null Het
Slc44a2 A G 9: 21,341,972 Y65C probably damaging Het
Snw1 T C 12: 87,458,904 K255E probably damaging Het
Sox6 T C 7: 115,662,322 I220V probably benign Het
Synpo2 A T 3: 123,080,056 I1146N probably damaging Het
Tas2r115 T C 6: 132,737,509 R160G probably benign Het
Tchh T C 3: 93,446,744 F1164L unknown Het
Tmem110 T A 14: 30,866,682 V122E probably damaging Het
Trim58 T C 11: 58,651,267 V351A probably damaging Het
Ttf1 T C 2: 29,074,654 S663P possibly damaging Het
Wdr59 A G 8: 111,451,068 Y920H Het
Zfp418 A G 7: 7,182,436 Y466C probably damaging Het
Zfp827 A T 8: 79,118,353 R717S possibly damaging Het
Other mutations in Entpd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Entpd7 APN 19 43729839 missense probably benign 0.00
R0056:Entpd7 UTSW 19 43725294 missense probably benign 0.09
R0118:Entpd7 UTSW 19 43704312 nonsense probably null
R0639:Entpd7 UTSW 19 43691094 missense probably benign 0.42
R1479:Entpd7 UTSW 19 43721840 missense probably damaging 1.00
R1532:Entpd7 UTSW 19 43691077 missense possibly damaging 0.76
R1647:Entpd7 UTSW 19 43721745 splice site probably benign
R1689:Entpd7 UTSW 19 43725476 missense probably damaging 0.96
R2230:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2231:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2422:Entpd7 UTSW 19 43728088 missense possibly damaging 0.66
R3807:Entpd7 UTSW 19 43725540 critical splice donor site probably null
R3914:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R3949:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4021:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4022:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4095:Entpd7 UTSW 19 43704201 missense probably damaging 1.00
R4737:Entpd7 UTSW 19 43691195 nonsense probably null
R5582:Entpd7 UTSW 19 43704994 missense probably damaging 1.00
R5653:Entpd7 UTSW 19 43691157 nonsense probably null
R5763:Entpd7 UTSW 19 43704266 missense probably damaging 1.00
R6508:Entpd7 UTSW 19 43691086 missense probably damaging 1.00
R7657:Entpd7 UTSW 19 43725467 missense possibly damaging 0.67
R8013:Entpd7 UTSW 19 43728055 missense probably benign 0.00
R8235:Entpd7 UTSW 19 43717545 missense probably damaging 1.00
R8880:Entpd7 UTSW 19 43704407 splice site probably benign
R9564:Entpd7 UTSW 19 43717450 missense probably benign 0.01
Z1176:Entpd7 UTSW 19 43725358 missense probably benign 0.43
Z1177:Entpd7 UTSW 19 43725497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGGCCCATAGGATGTG -3'
(R):5'- CACAAAGACAAGGGGAGCTTCC -3'

Sequencing Primer
(F):5'- CTTGGCCCATAGGATGTGTAAGATG -3'
(R):5'- TGACGCCAGACCAGGTAAACG -3'
Posted On 2022-03-25