Incidental Mutation 'R9319:Ino80'
ID 706017
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene Name INO80 complex subunit
Synonyms INO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R9319 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119373042-119477687 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119374524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1507 (D1507G)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920]
AlphaFold Q6ZPV2
Predicted Effect probably benign
Transcript: ENSMUST00000049920
AA Change: D1507G

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: D1507G

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik G A 2: 85,490,413 R349C probably damaging Het
4930590J08Rik A G 6: 91,945,465 D811G probably damaging Het
Akap13 A G 7: 75,609,088 T487A probably benign Het
Ankrd6 C T 4: 32,806,324 S643N probably benign Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Camk2b G T 11: 5,977,814 P489Q probably benign Het
Ccdc151 T C 9: 21,994,907 D245G probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cd22 T A 7: 30,869,904 N596Y probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cobl A T 11: 12,253,648 V1018E probably benign Het
Cttn T C 7: 144,463,363 E34G probably damaging Het
Dhx15 G A 5: 52,184,851 R42* probably null Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dlst G T 12: 85,123,811 R238L probably damaging Het
Dnah7c A G 1: 46,482,008 E232G possibly damaging Het
Dsg1b C T 18: 20,397,947 Q452* probably null Het
Elovl3 A G 19: 46,134,068 T102A possibly damaging Het
Epas1 A G 17: 86,797,117 S10G possibly damaging Het
Fanca T C 8: 123,291,451 I613V probably benign Het
Fat1 T A 8: 44,953,023 V937D probably damaging Het
Glipr1l1 G T 10: 112,062,217 A76S probably damaging Het
Ipo13 T C 4: 117,912,388 D69G probably benign Het
Kif2c T C 4: 117,178,248 probably null Het
Lrrc61 C A 6: 48,568,294 T17K probably damaging Het
Ltk C A 2: 119,759,615 E43D probably benign Het
Mcm3ap A G 10: 76,482,804 T720A probably damaging Het
Mcoln2 T A 3: 146,169,936 V81D probably damaging Het
Mturn T A 6: 54,681,795 V9D probably benign Het
Nrg1 T C 8: 31,833,176 D249G probably benign Het
Ntng2 T C 2: 29,201,109 probably benign Het
Pax3 T A 1: 78,103,442 M436L probably benign Het
Pias4 G A 10: 81,155,916 P53S unknown Het
Pkhd1l1 C T 15: 44,529,578 R1770C possibly damaging Het
Plk1 C A 7: 122,168,899 D447E probably damaging Het
Rsph10b A C 5: 143,966,519 M611L probably benign Het
Snrnp40 T C 4: 130,362,752 L90P possibly damaging Het
Snu13 T C 15: 82,044,017 T2A probably benign Het
Sptlc3 C T 2: 139,636,810 A563V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmx3 A G 18: 90,539,944 I373M probably benign Het
Tpbg C T 9: 85,843,938 probably benign Het
Troap T C 15: 99,077,563 I176T probably benign Het
Trpm2 G A 10: 77,942,942 Q397* probably null Het
Trpm2 A T 10: 77,949,198 V196E probably damaging Het
Vac14 T A 8: 110,634,386 I196N probably damaging Het
Vmn2r71 C T 7: 85,624,486 P836L probably damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
Chosen UTSW 2 119382269 splice site probably null
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7607:Ino80 UTSW 2 119382269 splice site probably null
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
R7975:Ino80 UTSW 2 119456467 splice site probably null
R7978:Ino80 UTSW 2 119439393 missense possibly damaging 0.93
R8376:Ino80 UTSW 2 119442487 missense probably benign 0.14
R8469:Ino80 UTSW 2 119379593 missense probably benign
R8720:Ino80 UTSW 2 119402387 missense probably damaging 1.00
R8751:Ino80 UTSW 2 119406908 missense probably benign
R8958:Ino80 UTSW 2 119383381 missense probably damaging 1.00
R8992:Ino80 UTSW 2 119379578 missense possibly damaging 0.93
R9346:Ino80 UTSW 2 119426958 missense possibly damaging 0.54
R9370:Ino80 UTSW 2 119402367 missense probably damaging 1.00
R9621:Ino80 UTSW 2 119450015 missense probably damaging 0.98
R9641:Ino80 UTSW 2 119445484 missense probably benign 0.08
R9650:Ino80 UTSW 2 119446983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCATGGTTACCGTCCTCCAG -3'
(R):5'- TGTCAGACATGTGCCCTCTC -3'

Sequencing Primer
(F):5'- CTCCAGAGGGGTTGGTGC -3'
(R):5'- TCTCCAGAGCCTGAAGAGTATGTC -3'
Posted On 2022-03-25