Mutagenetix > Incidental Mutation

Incidental Mutation 'R9319:Ino80'

706017

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R9319 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119374524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1507 (D1507G)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

AlphaFold

Q6ZPV2

Predicted Effect

probably benign
Transcript: ENSMUST00000049920
AA Change: D1507G

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: D1507G

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	G	A	2: 85,490,413	R349C	probably damaging	Het
4930590J08Rik	A	G	6: 91,945,465	D811G	probably damaging	Het
Akap13	A	G	7: 75,609,088	T487A	probably benign	Het
Ankrd6	C	T	4: 32,806,324	S643N	probably benign	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Camk2b	G	T	11: 5,977,814	P489Q	probably benign	Het
Ccdc151	T	C	9: 21,994,907	D245G	probably damaging	Het
Cd163l1	C	T	7: 140,228,027	P704S	possibly damaging	Het
Cd22	T	A	7: 30,869,904	N596Y	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Cobl	A	T	11: 12,253,648	V1018E	probably benign	Het
Cttn	T	C	7: 144,463,363	E34G	probably damaging	Het
Dhx15	G	A	5: 52,184,851	R42*	probably null	Het
Dlgap4	G	T	2: 156,704,594	R394L	possibly damaging	Het
Dlst	G	T	12: 85,123,811	R238L	probably damaging	Het
Dnah7c	A	G	1: 46,482,008	E232G	possibly damaging	Het
Dsg1b	C	T	18: 20,397,947	Q452*	probably null	Het
Elovl3	A	G	19: 46,134,068	T102A	possibly damaging	Het
Epas1	A	G	17: 86,797,117	S10G	possibly damaging	Het
Fanca	T	C	8: 123,291,451	I613V	probably benign	Het
Fat1	T	A	8: 44,953,023	V937D	probably damaging	Het
Glipr1l1	G	T	10: 112,062,217	A76S	probably damaging	Het
Ipo13	T	C	4: 117,912,388	D69G	probably benign	Het
Kif2c	T	C	4: 117,178,248		probably null	Het
Lrrc61	C	A	6: 48,568,294	T17K	probably damaging	Het
Ltk	C	A	2: 119,759,615	E43D	probably benign	Het
Mcm3ap	A	G	10: 76,482,804	T720A	probably damaging	Het
Mcoln2	T	A	3: 146,169,936	V81D	probably damaging	Het
Mturn	T	A	6: 54,681,795	V9D	probably benign	Het
Nrg1	T	C	8: 31,833,176	D249G	probably benign	Het
Ntng2	T	C	2: 29,201,109		probably benign	Het
Pax3	T	A	1: 78,103,442	M436L	probably benign	Het
Pias4	G	A	10: 81,155,916	P53S	unknown	Het
Pkhd1l1	C	T	15: 44,529,578	R1770C	possibly damaging	Het
Plk1	C	A	7: 122,168,899	D447E	probably damaging	Het
Rsph10b	A	C	5: 143,966,519	M611L	probably benign	Het
Snrnp40	T	C	4: 130,362,752	L90P	possibly damaging	Het
Snu13	T	C	15: 82,044,017	T2A	probably benign	Het
Sptlc3	C	T	2: 139,636,810	A563V	possibly damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmx3	A	G	18: 90,539,944	I373M	probably benign	Het
Tpbg	C	T	9: 85,843,938		probably benign	Het
Troap	T	C	15: 99,077,563	I176T	probably benign	Het
Trpm2	G	A	10: 77,942,942	Q397*	probably null	Het
Trpm2	A	T	10: 77,949,198	V196E	probably damaging	Het
Vac14	T	A	8: 110,634,386	I196N	probably damaging	Het
Vmn2r71	C	T	7: 85,624,486	P836L	probably damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00
R9621:Ino80	UTSW	2	119450015	missense	probably damaging	0.98
R9641:Ino80	UTSW	2	119445484	missense	probably benign	0.08
R9650:Ino80	UTSW	2	119446983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCATGGTTACCGTCCTCCAG -3'
(R):5'- TGTCAGACATGTGCCCTCTC -3'

Sequencing Primer
(F):5'- CTCCAGAGGGGTTGGTGC -3'
(R):5'- TCTCCAGAGCCTGAAGAGTATGTC -3'

Posted On

2022-03-25