Mutagenetix > Incidental Mutation

Incidental Mutation 'R9319:Kif2c'

706023

Institutional Source

Beutler Lab

Gene Symbol

Kif2c

Ensembl Gene

ENSMUSG00000028678

Gene Name

kinesin family member 2C

Synonyms

4930402F02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9319 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

117159639-117182639 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 117178248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000106436] [ENSMUST00000153953]

AlphaFold

Q922S8

PDB Structure

The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-ADP [X-RAY DIFFRACTION]
The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-AMPPNP [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000065896

SMART Domains

Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678

Domain	Start	End	E-Value	Type
low complexity region	192	205	N/A	INTRINSIC
KISc	252	590	1.04e-131	SMART
coiled coil region	615	647	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106436

SMART Domains

Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678

Domain	Start	End	E-Value	Type
low complexity region	141	154	N/A	INTRINSIC
KISc	201	539	1.04e-131	SMART
coiled coil region	564	596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153953

Meta Mutation Damage Score

0.9599

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin-like protein that functions as a microtubule-dependent molecular motor. The encoded protein can depolymerize microtubules at the plus end, thereby promoting mitotic chromosome segregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	G	A	2: 85,490,413	R349C	probably damaging	Het
4930590J08Rik	A	G	6: 91,945,465	D811G	probably damaging	Het
Akap13	A	G	7: 75,609,088	T487A	probably benign	Het
Ankrd6	C	T	4: 32,806,324	S643N	probably benign	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Camk2b	G	T	11: 5,977,814	P489Q	probably benign	Het
Ccdc151	T	C	9: 21,994,907	D245G	probably damaging	Het
Cd163l1	C	T	7: 140,228,027	P704S	possibly damaging	Het
Cd22	T	A	7: 30,869,904	N596Y	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Cobl	A	T	11: 12,253,648	V1018E	probably benign	Het
Cttn	T	C	7: 144,463,363	E34G	probably damaging	Het
Dhx15	G	A	5: 52,184,851	R42*	probably null	Het
Dlgap4	G	T	2: 156,704,594	R394L	possibly damaging	Het
Dlst	G	T	12: 85,123,811	R238L	probably damaging	Het
Dnah7c	A	G	1: 46,482,008	E232G	possibly damaging	Het
Dsg1b	C	T	18: 20,397,947	Q452*	probably null	Het
Elovl3	A	G	19: 46,134,068	T102A	possibly damaging	Het
Epas1	A	G	17: 86,797,117	S10G	possibly damaging	Het
Fanca	T	C	8: 123,291,451	I613V	probably benign	Het
Fat1	T	A	8: 44,953,023	V937D	probably damaging	Het
Glipr1l1	G	T	10: 112,062,217	A76S	probably damaging	Het
Ino80	T	C	2: 119,374,524	D1507G	probably benign	Het
Ipo13	T	C	4: 117,912,388	D69G	probably benign	Het
Lrrc61	C	A	6: 48,568,294	T17K	probably damaging	Het
Ltk	C	A	2: 119,759,615	E43D	probably benign	Het
Mcm3ap	A	G	10: 76,482,804	T720A	probably damaging	Het
Mcoln2	T	A	3: 146,169,936	V81D	probably damaging	Het
Mturn	T	A	6: 54,681,795	V9D	probably benign	Het
Nrg1	T	C	8: 31,833,176	D249G	probably benign	Het
Ntng2	T	C	2: 29,201,109		probably benign	Het
Pax3	T	A	1: 78,103,442	M436L	probably benign	Het
Pias4	G	A	10: 81,155,916	P53S	unknown	Het
Pkhd1l1	C	T	15: 44,529,578	R1770C	possibly damaging	Het
Plk1	C	A	7: 122,168,899	D447E	probably damaging	Het
Rsph10b	A	C	5: 143,966,519	M611L	probably benign	Het
Snrnp40	T	C	4: 130,362,752	L90P	possibly damaging	Het
Snu13	T	C	15: 82,044,017	T2A	probably benign	Het
Sptlc3	C	T	2: 139,636,810	A563V	possibly damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmx3	A	G	18: 90,539,944	I373M	probably benign	Het
Tpbg	C	T	9: 85,843,938		probably benign	Het
Troap	T	C	15: 99,077,563	I176T	probably benign	Het
Trpm2	G	A	10: 77,942,942	Q397*	probably null	Het
Trpm2	A	T	10: 77,949,198	V196E	probably damaging	Het
Vac14	T	A	8: 110,634,386	I196N	probably damaging	Het
Vmn2r71	C	T	7: 85,624,486	P836L	probably damaging	Het

Other mutations in Kif2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Kif2c	APN	4	117178246	missense	probably benign	0.01
IGL01020:Kif2c	APN	4	117166904	missense	probably damaging	1.00
IGL01131:Kif2c	APN	4	117172365	missense	probably damaging	1.00
IGL02131:Kif2c	APN	4	117177953	missense	possibly damaging	0.88
IGL02455:Kif2c	APN	4	117172354	missense	probably benign
IGL02556:Kif2c	APN	4	117162605	missense	probably damaging	0.98
IGL03084:Kif2c	APN	4	117178158	missense	possibly damaging	0.67
IGL03333:Kif2c	APN	4	117180636	missense	possibly damaging	0.87
IGL03353:Kif2c	APN	4	117166336	missense	probably benign	0.19
R0025:Kif2c	UTSW	4	117165517	missense	probably damaging	1.00
R0466:Kif2c	UTSW	4	117172292	missense	possibly damaging	0.83
R1069:Kif2c	UTSW	4	117178153	missense	probably damaging	0.97
R1519:Kif2c	UTSW	4	117169940	missense	probably damaging	1.00
R1594:Kif2c	UTSW	4	117178188	missense	probably benign	0.02
R1789:Kif2c	UTSW	4	117167361	missense	probably benign	0.18
R1894:Kif2c	UTSW	4	117162223	missense	probably benign	0.02
R2340:Kif2c	UTSW	4	117169841	missense	probably damaging	1.00
R2830:Kif2c	UTSW	4	117182448	splice site	probably null
R3734:Kif2c	UTSW	4	117162646	missense	probably benign	0.02
R4634:Kif2c	UTSW	4	117178240	missense	probably benign	0.04
R4720:Kif2c	UTSW	4	117171749	missense	probably benign
R4908:Kif2c	UTSW	4	117166411	missense	probably damaging	1.00
R5076:Kif2c	UTSW	4	117174869	unclassified	probably benign
R5855:Kif2c	UTSW	4	117182542	unclassified	probably benign
R6766:Kif2c	UTSW	4	117167083	missense	probably benign
R6767:Kif2c	UTSW	4	117178188	missense	probably benign	0.00
R6942:Kif2c	UTSW	4	117166378	missense	probably damaging	1.00
R7378:Kif2c	UTSW	4	117162029	missense	possibly damaging	0.46
R7526:Kif2c	UTSW	4	117182432	missense	possibly damaging	0.46
R7797:Kif2c	UTSW	4	117171743	missense	probably benign	0.00
R8087:Kif2c	UTSW	4	117165418	missense	possibly damaging	0.92
R9123:Kif2c	UTSW	4	117167094	missense	probably benign	0.09
U24488:Kif2c	UTSW	4	117182442	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATGTATTAGGATAAGGCCCCAGG -3'
(R):5'- TGGCTTGGAAACTGGAACCC -3'

Sequencing Primer
(F):5'- AGACAAAAATCAGCAAGAAGGTACC -3'
(R):5'- GCTTGGAAACTGGAACCCCATTC -3'

Posted On

2022-03-25