Incidental Mutation 'R9319:Snrnp40'
ID 706025
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Name small nuclear ribonucleoprotein 40 (U5)
Synonyms 0610009C03Rik, Wdr57
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9319 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 130360132-130390026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130362752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 90 (L90P)
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994] [ENSMUST00000134159]
AlphaFold Q6PE01
Predicted Effect possibly damaging
Transcript: ENSMUST00000105994
AA Change: L90P

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088
AA Change: L90P

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik G A 2: 85,490,413 R349C probably damaging Het
4930590J08Rik A G 6: 91,945,465 D811G probably damaging Het
Akap13 A G 7: 75,609,088 T487A probably benign Het
Ankrd6 C T 4: 32,806,324 S643N probably benign Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Camk2b G T 11: 5,977,814 P489Q probably benign Het
Ccdc151 T C 9: 21,994,907 D245G probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cd22 T A 7: 30,869,904 N596Y probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cobl A T 11: 12,253,648 V1018E probably benign Het
Cttn T C 7: 144,463,363 E34G probably damaging Het
Dhx15 G A 5: 52,184,851 R42* probably null Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dlst G T 12: 85,123,811 R238L probably damaging Het
Dnah7c A G 1: 46,482,008 E232G possibly damaging Het
Dsg1b C T 18: 20,397,947 Q452* probably null Het
Elovl3 A G 19: 46,134,068 T102A possibly damaging Het
Epas1 A G 17: 86,797,117 S10G possibly damaging Het
Fanca T C 8: 123,291,451 I613V probably benign Het
Fat1 T A 8: 44,953,023 V937D probably damaging Het
Glipr1l1 G T 10: 112,062,217 A76S probably damaging Het
Ino80 T C 2: 119,374,524 D1507G probably benign Het
Ipo13 T C 4: 117,912,388 D69G probably benign Het
Kif2c T C 4: 117,178,248 probably null Het
Lrrc61 C A 6: 48,568,294 T17K probably damaging Het
Ltk C A 2: 119,759,615 E43D probably benign Het
Mcm3ap A G 10: 76,482,804 T720A probably damaging Het
Mcoln2 T A 3: 146,169,936 V81D probably damaging Het
Mturn T A 6: 54,681,795 V9D probably benign Het
Nrg1 T C 8: 31,833,176 D249G probably benign Het
Pax3 T A 1: 78,103,442 M436L probably benign Het
Pias4 G A 10: 81,155,916 P53S unknown Het
Pkhd1l1 C T 15: 44,529,578 R1770C possibly damaging Het
Plk1 C A 7: 122,168,899 D447E probably damaging Het
Rsph10b A C 5: 143,966,519 M611L probably benign Het
Snu13 T C 15: 82,044,017 T2A probably benign Het
Sptlc3 C T 2: 139,636,810 A563V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmx3 A G 18: 90,539,944 I373M probably benign Het
Tpbg C T 9: 85,843,938 probably benign Het
Troap T C 15: 99,077,563 I176T probably benign Het
Trpm2 G A 10: 77,942,942 Q397* probably null Het
Trpm2 A T 10: 77,949,198 V196E probably damaging Het
Vac14 T A 8: 110,634,386 I196N probably damaging Het
Vmn2r71 C T 7: 85,624,486 P836L probably damaging Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130360221 missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130365100 missense probably benign 0.21
skywarp UTSW 4 130378043 splice site probably null
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130368273 missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130378043 splice site probably null
R0134:Snrnp40 UTSW 4 130378043 splice site probably null
R0211:Snrnp40 UTSW 4 130378043 splice site probably null
R0349:Snrnp40 UTSW 4 130378043 splice site probably null
R0371:Snrnp40 UTSW 4 130378043 splice site probably null
R0372:Snrnp40 UTSW 4 130378043 splice site probably null
R0376:Snrnp40 UTSW 4 130378043 splice site probably null
R0377:Snrnp40 UTSW 4 130378043 splice site probably null
R0400:Snrnp40 UTSW 4 130362650 missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130378043 splice site probably null
R0443:Snrnp40 UTSW 4 130378043 splice site probably null
R0486:Snrnp40 UTSW 4 130378043 splice site probably null
R0488:Snrnp40 UTSW 4 130378043 splice site probably null
R0568:Snrnp40 UTSW 4 130378043 splice site probably null
R0624:Snrnp40 UTSW 4 130362658 missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130378043 splice site probably null
R0650:Snrnp40 UTSW 4 130378043 splice site probably null
R0733:Snrnp40 UTSW 4 130378043 splice site probably null
R1161:Snrnp40 UTSW 4 130378043 splice site probably null
R1182:Snrnp40 UTSW 4 130378043 splice site probably null
R1234:Snrnp40 UTSW 4 130378043 splice site probably null
R1236:Snrnp40 UTSW 4 130378043 splice site probably null
R1305:Snrnp40 UTSW 4 130378043 splice site probably null
R1308:Snrnp40 UTSW 4 130378043 splice site probably null
R1333:Snrnp40 UTSW 4 130378043 splice site probably null
R1413:Snrnp40 UTSW 4 130378043 splice site probably null
R1569:Snrnp40 UTSW 4 130378043 splice site probably null
R1616:Snrnp40 UTSW 4 130378043 splice site probably null
R1656:Snrnp40 UTSW 4 130378043 splice site probably null
R1675:Snrnp40 UTSW 4 130378043 splice site probably null
R1759:Snrnp40 UTSW 4 130378043 splice site probably null
R1856:Snrnp40 UTSW 4 130378043 splice site probably null
R1901:Snrnp40 UTSW 4 130385975 missense probably damaging 0.98
R1912:Snrnp40 UTSW 4 130378043 splice site probably null
R1930:Snrnp40 UTSW 4 130378043 splice site probably null
R1931:Snrnp40 UTSW 4 130378043 splice site probably null
R2435:Snrnp40 UTSW 4 130384551 missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130368275 missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130362756 missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130388582 missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130362646 missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130365165 missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130384482 missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130378074 missense probably benign 0.00
R8412:Snrnp40 UTSW 4 130384523 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGCTATCCCTGACCCAGATG -3'
(R):5'- CGAAGCAACCTACTTTCCAATTAG -3'

Sequencing Primer
(F):5'- GCTATCCCTGACCCAGATGAGATG -3'
(R):5'- ACCTACTTTCCAATTAGTACATTTCC -3'
Posted On 2022-03-25