Mutagenetix > Incidental Mutation

Incidental Mutation 'R9319:Cd163l1'

706036

Institutional Source

Beutler Lab

Gene Symbol

Cd163l1

Ensembl Gene

ENSMUSG00000025461

Gene Name

CD163 molecule-like 1

Synonyms

E430002D04Rik, Scart1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9319 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140218267-140231145 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 140228027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 704 (P704S)

Ref Sequence

ENSEMBL: ENSMUSP00000147699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084460] [ENSMUST00000209398] [ENSMUST00000209637]

AlphaFold

A0A1B0GSB0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084460
AA Change: P704S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081497
Gene: ENSMUSG00000025461
AA Change: P704S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SR	32	132	1.45e-30	SMART
SR	139	230	4.28e-6	SMART
SR	235	333	2.76e-36	SMART
SR	335	435	1.32e-33	SMART
SR	441	541	5.01e-25	SMART
SR	546	646	7.16e-53	SMART
SR	651	752	3.44e-14	SMART
SR	780	880	8.96e-45	SMART
low complexity region	882	898	N/A	INTRINSIC
transmembrane domain	907	929	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209376

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209398
AA Change: P704S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209637
AA Change: P704S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209840

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211540

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (48/48)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	G	A	2: 85,490,413	R349C	probably damaging	Het
4930590J08Rik	A	G	6: 91,945,465	D811G	probably damaging	Het
Akap13	A	G	7: 75,609,088	T487A	probably benign	Het
Ankrd6	C	T	4: 32,806,324	S643N	probably benign	Het
Apcdd1	C	T	18: 62,922,660		probably benign	Het
Camk2b	G	T	11: 5,977,814	P489Q	probably benign	Het
Ccdc151	T	C	9: 21,994,907	D245G	probably damaging	Het
Cd22	T	A	7: 30,869,904	N596Y	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Cobl	A	T	11: 12,253,648	V1018E	probably benign	Het
Cttn	T	C	7: 144,463,363	E34G	probably damaging	Het
Dhx15	G	A	5: 52,184,851	R42*	probably null	Het
Dlgap4	G	T	2: 156,704,594	R394L	possibly damaging	Het
Dlst	G	T	12: 85,123,811	R238L	probably damaging	Het
Dnah7c	A	G	1: 46,482,008	E232G	possibly damaging	Het
Dsg1b	C	T	18: 20,397,947	Q452*	probably null	Het
Elovl3	A	G	19: 46,134,068	T102A	possibly damaging	Het
Epas1	A	G	17: 86,797,117	S10G	possibly damaging	Het
Fanca	T	C	8: 123,291,451	I613V	probably benign	Het
Fat1	T	A	8: 44,953,023	V937D	probably damaging	Het
Glipr1l1	G	T	10: 112,062,217	A76S	probably damaging	Het
Ino80	T	C	2: 119,374,524	D1507G	probably benign	Het
Ipo13	T	C	4: 117,912,388	D69G	probably benign	Het
Kif2c	T	C	4: 117,178,248		probably null	Het
Lrrc61	C	A	6: 48,568,294	T17K	probably damaging	Het
Ltk	C	A	2: 119,759,615	E43D	probably benign	Het
Mcm3ap	A	G	10: 76,482,804	T720A	probably damaging	Het
Mcoln2	T	A	3: 146,169,936	V81D	probably damaging	Het
Mturn	T	A	6: 54,681,795	V9D	probably benign	Het
Nrg1	T	C	8: 31,833,176	D249G	probably benign	Het
Ntng2	T	C	2: 29,201,109		probably benign	Het
Pax3	T	A	1: 78,103,442	M436L	probably benign	Het
Pias4	G	A	10: 81,155,916	P53S	unknown	Het
Pkhd1l1	C	T	15: 44,529,578	R1770C	possibly damaging	Het
Plk1	C	A	7: 122,168,899	D447E	probably damaging	Het
Rsph10b	A	C	5: 143,966,519	M611L	probably benign	Het
Snrnp40	T	C	4: 130,362,752	L90P	possibly damaging	Het
Snu13	T	C	15: 82,044,017	T2A	probably benign	Het
Sptlc3	C	T	2: 139,636,810	A563V	possibly damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tmx3	A	G	18: 90,539,944	I373M	probably benign	Het
Tpbg	C	T	9: 85,843,938		probably benign	Het
Troap	T	C	15: 99,077,563	I176T	probably benign	Het
Trpm2	G	A	10: 77,942,942	Q397*	probably null	Het
Trpm2	A	T	10: 77,949,198	V196E	probably damaging	Het
Vac14	T	A	8: 110,634,386	I196N	probably damaging	Het
Vmn2r71	C	T	7: 85,624,486	P836L	probably damaging	Het

Other mutations in Cd163l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cd163l1	APN	7	140224639	critical splice donor site	probably null
IGL01921:Cd163l1	APN	7	140228719	nonsense	probably null
IGL02168:Cd163l1	APN	7	140223486	missense	probably benign	0.02
IGL02306:Cd163l1	APN	7	140223356	missense	probably damaging	1.00
IGL02323:Cd163l1	APN	7	140228659	missense	probably benign	0.10
IGL02457:Cd163l1	APN	7	140220395	missense	probably benign	0.07
IGL02543:Cd163l1	APN	7	140220578	missense	probably benign	0.00
IGL02831:Cd163l1	APN	7	140228521	missense	probably benign	0.14
IGL03289:Cd163l1	APN	7	140229060	critical splice donor site	probably null
lop	UTSW	7	140224463	missense	possibly damaging	0.91
R0357:Cd163l1	UTSW	7	140227895	missense	probably damaging	1.00
R0513:Cd163l1	UTSW	7	140224960	nonsense	probably null
R1023:Cd163l1	UTSW	7	140224463	missense	possibly damaging	0.91
R1519:Cd163l1	UTSW	7	140228156	missense	probably benign	0.07
R1711:Cd163l1	UTSW	7	140220609	missense	probably damaging	1.00
R2327:Cd163l1	UTSW	7	140223977	missense	possibly damaging	0.48
R4957:Cd163l1	UTSW	7	140228522	missense	probably damaging	0.99
R5421:Cd163l1	UTSW	7	140223900	missense	probably damaging	1.00
R5422:Cd163l1	UTSW	7	140224155	missense	probably benign	0.03
R5851:Cd163l1	UTSW	7	140228027	missense	possibly damaging	0.93
R5906:Cd163l1	UTSW	7	140228799	missense	probably damaging	1.00
R5930:Cd163l1	UTSW	7	140230446	missense	probably benign	0.32
R6376:Cd163l1	UTSW	7	140228729	missense	probably damaging	1.00
R7380:Cd163l1	UTSW	7	140224877	missense	possibly damaging	0.47
R7389:Cd163l1	UTSW	7	140228791	missense	possibly damaging	0.95
R7466:Cd163l1	UTSW	7	140220706	critical splice donor site	probably null
R7686:Cd163l1	UTSW	7	140222203	nonsense	probably null
R7722:Cd163l1	UTSW	7	140222386	nonsense	probably null
R8535:Cd163l1	UTSW	7	140224721	missense	probably benign	0.06
R8900:Cd163l1	UTSW	7	140228565	nonsense	probably null
R9041:Cd163l1	UTSW	7	140228590	missense	probably damaging	1.00
R9116:Cd163l1	UTSW	7	140228364	missense	probably benign
Z1176:Cd163l1	UTSW	7	140224857	missense	probably benign	0.17
Z1186:Cd163l1	UTSW	7	140224490	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- GAATCTGTGGCTCTGAGGCTTC -3'
(R):5'- CATGAAGTTCAGTGGCAGGTG -3'

Sequencing Primer
(F):5'- AGGCTTCGAGGTGGCACTAG -3'
(R):5'- AGAAACTTTTACTGGGGTCCACC -3'

Posted On

2022-03-25