Incidental Mutation 'R9319:Trpm2'
ID 706046
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms Trrp7, TRPC7, LTRPC2, 9830168K16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R9319 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 77743556-77805746 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 77778776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 397 (Q397*)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect probably null
Transcript: ENSMUST00000105401
AA Change: Q397*
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: Q397*

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,922,446 (GRCm39) D811G probably damaging Het
Akap13 A G 7: 75,258,836 (GRCm39) T487A probably benign Het
Ankrd6 C T 4: 32,806,324 (GRCm39) S643N probably benign Het
Apcdd1 C T 18: 63,055,731 (GRCm39) probably benign Het
Camk2b G T 11: 5,927,814 (GRCm39) P489Q probably benign Het
Cd22 T A 7: 30,569,329 (GRCm39) N596Y probably damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Cobl A T 11: 12,203,648 (GRCm39) V1018E probably benign Het
Cttn T C 7: 144,017,100 (GRCm39) E34G probably damaging Het
Dhx15 G A 5: 52,342,193 (GRCm39) R42* probably null Het
Dlgap4 G T 2: 156,546,514 (GRCm39) R394L possibly damaging Het
Dlst G T 12: 85,170,585 (GRCm39) R238L probably damaging Het
Dnah7c A G 1: 46,521,168 (GRCm39) E232G possibly damaging Het
Dsg1b C T 18: 20,531,004 (GRCm39) Q452* probably null Het
Elovl3 A G 19: 46,122,507 (GRCm39) T102A possibly damaging Het
Epas1 A G 17: 87,104,545 (GRCm39) S10G possibly damaging Het
Fads2b G A 2: 85,320,757 (GRCm39) R349C probably damaging Het
Fanca T C 8: 124,018,190 (GRCm39) I613V probably benign Het
Fat1 T A 8: 45,406,060 (GRCm39) V937D probably damaging Het
Glipr1l1 G T 10: 111,898,122 (GRCm39) A76S probably damaging Het
Ino80 T C 2: 119,205,005 (GRCm39) D1507G probably benign Het
Ipo13 T C 4: 117,769,585 (GRCm39) D69G probably benign Het
Kif2c T C 4: 117,035,445 (GRCm39) probably null Het
Lrrc61 C A 6: 48,545,228 (GRCm39) T17K probably damaging Het
Ltk C A 2: 119,590,096 (GRCm39) E43D probably benign Het
Mcm3ap A G 10: 76,318,638 (GRCm39) T720A probably damaging Het
Mcoln2 T A 3: 145,875,691 (GRCm39) V81D probably damaging Het
Mturn T A 6: 54,658,780 (GRCm39) V9D probably benign Het
Nrg1 T C 8: 32,323,204 (GRCm39) D249G probably benign Het
Ntng2 T C 2: 29,091,121 (GRCm39) probably benign Het
Odad3 T C 9: 21,906,203 (GRCm39) D245G probably damaging Het
Pax3 T A 1: 78,080,079 (GRCm39) M436L probably benign Het
Pias4 G A 10: 80,991,750 (GRCm39) P53S unknown Het
Pkhd1l1 C T 15: 44,392,974 (GRCm39) R1770C possibly damaging Het
Plk1 C A 7: 121,768,122 (GRCm39) D447E probably damaging Het
Rsph10b A C 5: 143,903,337 (GRCm39) M611L probably benign Het
Scart1 C T 7: 139,807,940 (GRCm39) P704S possibly damaging Het
Snrnp40 T C 4: 130,256,545 (GRCm39) L90P possibly damaging Het
Snu13 T C 15: 81,928,218 (GRCm39) T2A probably benign Het
Sptlc3 C T 2: 139,478,730 (GRCm39) A563V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmx3 A G 18: 90,558,068 (GRCm39) I373M probably benign Het
Tpbg C T 9: 85,725,991 (GRCm39) probably benign Het
Troap T C 15: 98,975,444 (GRCm39) I176T probably benign Het
Vac14 T A 8: 111,361,018 (GRCm39) I196N probably damaging Het
Vmn2r71 C T 7: 85,273,694 (GRCm39) P836L probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,778,749 (GRCm39) splice site probably null
IGL00773:Trpm2 APN 10 77,785,048 (GRCm39) nonsense probably null
IGL00962:Trpm2 APN 10 77,779,750 (GRCm39) splice site probably benign
IGL01093:Trpm2 APN 10 77,768,114 (GRCm39) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,781,659 (GRCm39) splice site probably benign
IGL01301:Trpm2 APN 10 77,759,818 (GRCm39) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,778,830 (GRCm39) nonsense probably null
IGL02175:Trpm2 APN 10 77,773,741 (GRCm39) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,748,503 (GRCm39) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,754,820 (GRCm39) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,765,112 (GRCm39) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,754,743 (GRCm39) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,753,568 (GRCm39) missense probably benign
IGL03405:Trpm2 APN 10 77,801,906 (GRCm39) splice site probably benign
Fugit UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
scusate UTSW 10 77,802,828 (GRCm39) nonsense probably null
temporal UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,759,818 (GRCm39) missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,779,824 (GRCm39) splice site probably benign
R0332:Trpm2 UTSW 10 77,783,822 (GRCm39) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,759,350 (GRCm39) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,765,122 (GRCm39) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,759,398 (GRCm39) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,802,828 (GRCm39) nonsense probably null
R1518:Trpm2 UTSW 10 77,778,839 (GRCm39) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,778,833 (GRCm39) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,778,910 (GRCm39) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,771,709 (GRCm39) splice site probably null
R1673:Trpm2 UTSW 10 77,778,778 (GRCm39) missense probably benign
R1912:Trpm2 UTSW 10 77,781,710 (GRCm39) missense probably benign 0.10
R1932:Trpm2 UTSW 10 77,776,992 (GRCm39) missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77,783,823 (GRCm39) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,761,600 (GRCm39) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,756,305 (GRCm39) nonsense probably null
R2217:Trpm2 UTSW 10 77,777,016 (GRCm39) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,754,798 (GRCm39) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,750,640 (GRCm39) splice site probably benign
R2395:Trpm2 UTSW 10 77,783,714 (GRCm39) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,766,471 (GRCm39) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,770,558 (GRCm39) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,777,008 (GRCm39) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,747,208 (GRCm39) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,768,136 (GRCm39) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,769,476 (GRCm39) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,753,559 (GRCm39) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,765,053 (GRCm39) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,770,902 (GRCm39) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,759,427 (GRCm39) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,781,750 (GRCm39) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,773,972 (GRCm39) missense probably benign 0.05
R4825:Trpm2 UTSW 10 77,777,007 (GRCm39) missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77,768,023 (GRCm39) nonsense probably null
R4943:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,753,626 (GRCm39) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,801,852 (GRCm39) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,759,355 (GRCm39) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,771,795 (GRCm39) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,795,773 (GRCm39) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,767,973 (GRCm39) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,748,470 (GRCm39) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,774,187 (GRCm39) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,801,814 (GRCm39) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,795,734 (GRCm39) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,753,547 (GRCm39) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,770,877 (GRCm39) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77,768,061 (GRCm39) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,750,574 (GRCm39) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,771,725 (GRCm39) missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7036:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7113:Trpm2 UTSW 10 77,783,765 (GRCm39) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,759,848 (GRCm39) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,771,710 (GRCm39) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,759,389 (GRCm39) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,750,568 (GRCm39) missense probably benign
R7527:Trpm2 UTSW 10 77,801,894 (GRCm39) missense probably benign 0.01
R7571:Trpm2 UTSW 10 77,773,784 (GRCm39) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,773,885 (GRCm39) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,761,623 (GRCm39) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,759,340 (GRCm39) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,783,731 (GRCm39) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,771,836 (GRCm39) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,801,859 (GRCm39) nonsense probably null
R8340:Trpm2 UTSW 10 77,759,458 (GRCm39) nonsense probably null
R8354:Trpm2 UTSW 10 77,769,483 (GRCm39) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,747,236 (GRCm39) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,746,086 (GRCm39) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,768,128 (GRCm39) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,765,122 (GRCm39) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,777,014 (GRCm39) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,785,032 (GRCm39) missense probably damaging 1.00
R9381:Trpm2 UTSW 10 77,747,191 (GRCm39) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,747,226 (GRCm39) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,747,224 (GRCm39) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,748,467 (GRCm39) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,766,389 (GRCm39) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,756,320 (GRCm39) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,773,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAAACCCAGTTCTCCTTTGG -3'
(R):5'- CCGCTTTGGCAGACAATCTAC -3'

Sequencing Primer
(F):5'- GTCACATGCTTCAAACTCTCAGTG -3'
(R):5'- GCTTTGGCAGACAATCTACAATGC -3'
Posted On 2022-03-25