Incidental Mutation 'R9319:Apcdd1'
ID 706058
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R9319 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 62922660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably benign
Transcript: ENSMUST00000096554
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163716
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik G A 2: 85,490,413 R349C probably damaging Het
4930590J08Rik A G 6: 91,945,465 D811G probably damaging Het
Akap13 A G 7: 75,609,088 T487A probably benign Het
Ankrd6 C T 4: 32,806,324 S643N probably benign Het
Camk2b G T 11: 5,977,814 P489Q probably benign Het
Ccdc151 T C 9: 21,994,907 D245G probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cd22 T A 7: 30,869,904 N596Y probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Cobl A T 11: 12,253,648 V1018E probably benign Het
Cttn T C 7: 144,463,363 E34G probably damaging Het
Dhx15 G A 5: 52,184,851 R42* probably null Het
Dlgap4 G T 2: 156,704,594 R394L possibly damaging Het
Dlst G T 12: 85,123,811 R238L probably damaging Het
Dnah7c A G 1: 46,482,008 E232G possibly damaging Het
Dsg1b C T 18: 20,397,947 Q452* probably null Het
Elovl3 A G 19: 46,134,068 T102A possibly damaging Het
Epas1 A G 17: 86,797,117 S10G possibly damaging Het
Fanca T C 8: 123,291,451 I613V probably benign Het
Fat1 T A 8: 44,953,023 V937D probably damaging Het
Glipr1l1 G T 10: 112,062,217 A76S probably damaging Het
Ino80 T C 2: 119,374,524 D1507G probably benign Het
Ipo13 T C 4: 117,912,388 D69G probably benign Het
Kif2c T C 4: 117,178,248 probably null Het
Lrrc61 C A 6: 48,568,294 T17K probably damaging Het
Ltk C A 2: 119,759,615 E43D probably benign Het
Mcm3ap A G 10: 76,482,804 T720A probably damaging Het
Mcoln2 T A 3: 146,169,936 V81D probably damaging Het
Mturn T A 6: 54,681,795 V9D probably benign Het
Nrg1 T C 8: 31,833,176 D249G probably benign Het
Pax3 T A 1: 78,103,442 M436L probably benign Het
Pias4 G A 10: 81,155,916 P53S unknown Het
Pkhd1l1 C T 15: 44,529,578 R1770C possibly damaging Het
Plk1 C A 7: 122,168,899 D447E probably damaging Het
Rsph10b A C 5: 143,966,519 M611L probably benign Het
Snrnp40 T C 4: 130,362,752 L90P possibly damaging Het
Snu13 T C 15: 82,044,017 T2A probably benign Het
Sptlc3 C T 2: 139,636,810 A563V possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmx3 A G 18: 90,539,944 I373M probably benign Het
Tpbg C T 9: 85,843,938 probably benign Het
Troap T C 15: 99,077,563 I176T probably benign Het
Trpm2 G A 10: 77,942,942 Q397* probably null Het
Trpm2 A T 10: 77,949,198 V196E probably damaging Het
Vac14 T A 8: 110,634,386 I196N probably damaging Het
Vmn2r71 C T 7: 85,624,486 P836L probably damaging Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 62950086 missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACCTCTGAGCTGTGCAC -3'
(R):5'- TTCCAGAAAGAACACTGCAGCG -3'

Sequencing Primer
(F):5'- GCTGCGGTTCGGAGTCC -3'
(R):5'- AAAACCACTGCGGGTGC -3'
Posted On 2022-03-25