Incidental Mutation 'R0739:Sptan1'
ID 70609
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Name spectrin alpha, non-erythrocytic 1
Synonyms alpha-fodrin, alphaII-spectrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 038920-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0739 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 29855572-29921463 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29903530 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1502 (I1502F)
Ref Sequence ENSEMBL: ENSMUSP00000109348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
AlphaFold P16546
Predicted Effect probably damaging
Transcript: ENSMUST00000046257
AA Change: I1502F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: I1502F

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095083
AA Change: I1522F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: I1522F

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100225
AA Change: I1522F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: I1522F

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113717
AA Change: I1502F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: I1502F

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113719
AA Change: I1502F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: I1502F

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129241
AA Change: I1522F
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: I1522F

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Meta Mutation Damage Score 0.4485 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,227,961 (GRCm39) E327G probably damaging Het
Adcy6 T C 15: 98,496,260 (GRCm39) D593G probably benign Het
Ankmy1 T C 1: 92,816,370 (GRCm39) D248G probably damaging Het
Atp2a1 T C 7: 126,047,428 (GRCm39) I743V possibly damaging Het
Axdnd1 T C 1: 156,208,456 (GRCm39) N396D possibly damaging Het
Cacna1e C T 1: 154,318,024 (GRCm39) A1391T probably damaging Het
Ccr8 G A 9: 119,923,415 (GRCm39) G177S probably damaging Het
Clmn C T 12: 104,747,276 (GRCm39) G757D possibly damaging Het
Cntn2 T A 1: 132,456,750 (GRCm39) I99F probably damaging Het
D6Ertd527e C G 6: 87,088,650 (GRCm39) A271G unknown Het
Dnah1 A T 14: 30,987,872 (GRCm39) C3515* probably null Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Elovl4 A G 9: 83,667,162 (GRCm39) F65S probably damaging Het
F5 G C 1: 164,026,486 (GRCm39) R1686P probably damaging Het
Fbn1 T C 2: 125,209,550 (GRCm39) E938G probably benign Het
Foxn1 T C 11: 78,249,825 (GRCm39) T567A probably benign Het
Gabrr1 T C 4: 33,162,781 (GRCm39) M449T probably benign Het
Gdf2 C T 14: 33,663,178 (GRCm39) P24L probably damaging Het
Itgb3bp T C 4: 99,690,433 (GRCm39) I29V probably benign Het
Kcnk7 C T 19: 5,754,830 (GRCm39) probably null Het
Klf11 T C 12: 24,710,247 (GRCm39) S432P probably damaging Het
Neo1 C T 9: 58,829,160 (GRCm39) A580T probably benign Het
Nexmif G T X: 103,128,555 (GRCm39) Q1121K probably benign Het
Or51aa5 T C 7: 103,166,931 (GRCm39) Y220C probably damaging Het
Or51f5 T C 7: 102,423,872 (GRCm39) I47T probably damaging Het
Or5p62 T C 7: 107,771,217 (GRCm39) T245A probably benign Het
Osgepl1 G T 1: 53,362,354 (GRCm39) E399* probably null Het
Parvg T A 15: 84,215,222 (GRCm39) V197E probably damaging Het
Pcyt2 A G 11: 120,502,870 (GRCm39) L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 (GRCm39) D391G possibly damaging Het
Psmd2 C T 16: 20,474,079 (GRCm39) R261C probably benign Het
Ptpn13 T C 5: 103,722,998 (GRCm39) F1981L probably benign Het
Rbp3 A T 14: 33,680,604 (GRCm39) I1069F probably benign Het
Rhbdf2 A T 11: 116,490,987 (GRCm39) L655Q probably damaging Het
Sec16a A T 2: 26,331,063 (GRCm39) N317K possibly damaging Het
Serpina3f T C 12: 104,184,612 (GRCm39) V252A probably damaging Het
Slc22a23 C T 13: 34,528,366 (GRCm39) G139S possibly damaging Het
Smyd2 T C 1: 189,621,059 (GRCm39) T220A possibly damaging Het
Snrpb2 T A 2: 142,907,281 (GRCm39) probably benign Het
Spopfm1 A G 3: 94,173,102 (GRCm39) M37V probably benign Het
Srprb A T 9: 103,074,794 (GRCm39) L116H probably damaging Het
Stradb T A 1: 59,016,174 (GRCm39) probably benign Het
Tm9sf4 C A 2: 153,045,734 (GRCm39) F535L probably damaging Het
Tmprss15 A T 16: 78,821,736 (GRCm39) S440T possibly damaging Het
Tpr C T 1: 150,283,248 (GRCm39) A293V possibly damaging Het
Usp34 C T 11: 23,417,243 (GRCm39) T2964I possibly damaging Het
Usp35 C A 7: 96,960,874 (GRCm39) E851* probably null Het
Zc3h14 T A 12: 98,723,460 (GRCm39) V250D probably damaging Het
Zfp568 T A 7: 29,722,746 (GRCm39) C564S probably damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29,883,968 (GRCm39) critical splice donor site probably null
IGL00932:Sptan1 APN 2 29,905,622 (GRCm39) missense probably damaging 1.00
IGL00945:Sptan1 APN 2 29,890,083 (GRCm39) splice site probably benign
IGL01070:Sptan1 APN 2 29,904,185 (GRCm39) critical splice donor site probably null
IGL01625:Sptan1 APN 2 29,916,126 (GRCm39) missense probably damaging 1.00
IGL01657:Sptan1 APN 2 29,908,491 (GRCm39) missense probably benign 0.12
IGL01795:Sptan1 APN 2 29,908,501 (GRCm39) missense probably benign 0.07
IGL01982:Sptan1 APN 2 29,909,980 (GRCm39) missense probably damaging 1.00
IGL02040:Sptan1 APN 2 29,903,725 (GRCm39) missense probably benign 0.43
IGL02158:Sptan1 APN 2 29,920,336 (GRCm39) missense probably damaging 0.97
IGL02370:Sptan1 APN 2 29,920,752 (GRCm39) missense probably damaging 0.99
IGL02507:Sptan1 APN 2 29,906,067 (GRCm39) missense probably damaging 1.00
IGL02552:Sptan1 APN 2 29,908,486 (GRCm39) missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29,888,195 (GRCm39) missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29,868,588 (GRCm39) missense probably benign 0.03
IGL02725:Sptan1 APN 2 29,886,055 (GRCm39) missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29,881,045 (GRCm39) missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29,876,505 (GRCm39) missense probably damaging 1.00
IGL03405:Sptan1 APN 2 29,915,593 (GRCm39) missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0094:Sptan1 UTSW 2 29,896,635 (GRCm39) missense probably benign 0.37
R0230:Sptan1 UTSW 2 29,900,704 (GRCm39) splice site probably benign
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0366:Sptan1 UTSW 2 29,882,764 (GRCm39) splice site probably null
R0368:Sptan1 UTSW 2 29,883,927 (GRCm39) missense probably benign 0.29
R0396:Sptan1 UTSW 2 29,881,045 (GRCm39) missense probably damaging 1.00
R0423:Sptan1 UTSW 2 29,918,684 (GRCm39) missense probably null
R0448:Sptan1 UTSW 2 29,916,822 (GRCm39) missense probably damaging 1.00
R0485:Sptan1 UTSW 2 29,903,860 (GRCm39) splice site probably benign
R0580:Sptan1 UTSW 2 29,897,587 (GRCm39) missense probably damaging 0.99
R0924:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0930:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29,870,075 (GRCm39) splice site probably null
R1352:Sptan1 UTSW 2 29,911,199 (GRCm39) splice site probably benign
R1456:Sptan1 UTSW 2 29,870,215 (GRCm39) critical splice donor site probably null
R1537:Sptan1 UTSW 2 29,916,034 (GRCm39) missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 29,917,139 (GRCm39) missense probably damaging 1.00
R1612:Sptan1 UTSW 2 29,893,348 (GRCm39) missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29,876,432 (GRCm39) missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29,882,013 (GRCm39) splice site probably benign
R1879:Sptan1 UTSW 2 29,885,540 (GRCm39) missense probably damaging 1.00
R1893:Sptan1 UTSW 2 29,910,472 (GRCm39) missense probably damaging 0.98
R1914:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R1915:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R2022:Sptan1 UTSW 2 29,897,573 (GRCm39) missense probably damaging 0.96
R2050:Sptan1 UTSW 2 29,892,250 (GRCm39) missense probably benign
R2103:Sptan1 UTSW 2 29,920,483 (GRCm39) missense probably damaging 1.00
R2162:Sptan1 UTSW 2 29,908,588 (GRCm39) splice site probably benign
R2931:Sptan1 UTSW 2 29,908,500 (GRCm39) missense probably benign
R3726:Sptan1 UTSW 2 29,908,431 (GRCm39) missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 29,920,037 (GRCm39) missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 29,916,600 (GRCm39) missense probably damaging 1.00
R4378:Sptan1 UTSW 2 29,915,581 (GRCm39) missense probably damaging 1.00
R4424:Sptan1 UTSW 2 29,919,721 (GRCm39) intron probably benign
R4718:Sptan1 UTSW 2 29,921,074 (GRCm39) missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29,886,447 (GRCm39) missense probably damaging 0.98
R4849:Sptan1 UTSW 2 29,901,054 (GRCm39) missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29,868,455 (GRCm39) missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5181:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5383:Sptan1 UTSW 2 29,901,340 (GRCm39) missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29,876,504 (GRCm39) nonsense probably null
R5592:Sptan1 UTSW 2 29,876,731 (GRCm39) intron probably benign
R5639:Sptan1 UTSW 2 29,881,005 (GRCm39) nonsense probably null
R5801:Sptan1 UTSW 2 29,920,613 (GRCm39) splice site probably null
R5947:Sptan1 UTSW 2 29,884,379 (GRCm39) critical splice donor site probably null
R6056:Sptan1 UTSW 2 29,886,794 (GRCm39) missense probably benign 0.36
R6090:Sptan1 UTSW 2 29,883,899 (GRCm39) missense probably damaging 1.00
R6146:Sptan1 UTSW 2 29,894,535 (GRCm39) missense probably benign 0.01
R6254:Sptan1 UTSW 2 29,897,561 (GRCm39) missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 29,908,527 (GRCm39) missense probably damaging 1.00
R6521:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 29,920,985 (GRCm39) missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29,873,221 (GRCm39) missense probably benign 0.02
R7248:Sptan1 UTSW 2 29,892,311 (GRCm39) missense probably benign 0.10
R7282:Sptan1 UTSW 2 29,876,941 (GRCm39) missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29,870,209 (GRCm39) missense probably damaging 1.00
R7585:Sptan1 UTSW 2 29,890,068 (GRCm39) missense probably benign 0.06
R7779:Sptan1 UTSW 2 29,911,319 (GRCm39) missense probably damaging 1.00
R8051:Sptan1 UTSW 2 29,920,171 (GRCm39) missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29,884,351 (GRCm39) missense probably benign 0.22
R8103:Sptan1 UTSW 2 29,910,055 (GRCm39) missense probably damaging 1.00
R8283:Sptan1 UTSW 2 29,870,212 (GRCm39) missense probably damaging 1.00
R8507:Sptan1 UTSW 2 29,916,596 (GRCm39) missense probably damaging 1.00
R8963:Sptan1 UTSW 2 29,873,744 (GRCm39) missense possibly damaging 0.92
R9126:Sptan1 UTSW 2 29,920,597 (GRCm39) missense probably damaging 0.99
R9206:Sptan1 UTSW 2 29,920,724 (GRCm39) missense possibly damaging 0.90
R9273:Sptan1 UTSW 2 29,880,977 (GRCm39) missense possibly damaging 0.88
X0028:Sptan1 UTSW 2 29,910,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTGTTCCGATCCTGCTACCAG -3'
(R):5'- GCTCTACTCAGTGACAAGGCACTTC -3'

Sequencing Primer
(F):5'- CCAGTTAGTTTCGTCACTCAAAG -3'
(R):5'- GAGCCCCTTACCTGGATGTTG -3'
Posted On 2013-09-30