Incidental Mutation 'R9320:Tenm2'
ID 706110
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms 2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.521) question?
Stock # R9320 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 36006656-37235964 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36023647 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 2354 (E2354D)
Ref Sequence ENSEMBL: ENSMUSP00000052014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057207
AA Change: E2354D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: E2354D

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102801
AA Change: E2353D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: E2353D

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163524
AA Change: E2353D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: E2353D

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,097 Y1451H probably damaging Het
Abca7 T A 10: 79,997,637 M8K possibly damaging Het
Ablim3 C A 18: 61,839,734 R238L probably damaging Het
Adar T A 3: 89,751,061 Y1141* probably null Het
Arid2 T C 15: 96,371,186 I1060T probably damaging Het
Armc2 A T 10: 41,963,778 V397D possibly damaging Het
Astn2 A G 4: 66,404,149 V71A unknown Het
Bcat2 A G 7: 45,585,118 D141G probably damaging Het
Bicdl1 C A 5: 115,724,710 R162L probably damaging Het
Btbd17 A G 11: 114,794,084 I43T possibly damaging Het
C2cd5 A T 6: 143,031,293 C698* probably null Het
Calr T A 8: 84,846,000 K87* probably null Het
Cap2 C T 13: 46,615,342 T208I probably benign Het
Col14a1 A T 15: 55,501,384 M1630L probably benign Het
Copg1 T G 6: 87,910,090 S816A possibly damaging Het
Csf2ra C A 19: 61,226,842 A112S possibly damaging Het
Cwc27 T A 13: 104,797,291 H241L probably benign Het
Dgki T A 6: 36,915,487 E852V probably damaging Het
Dpp6 T C 5: 27,663,523 probably null Het
Dynlrb1 T C 2: 155,247,940 probably null Het
Ehhadh C T 16: 21,773,531 V141I probably benign Het
Esyt3 A G 9: 99,311,991 L865P probably damaging Het
Fam83h T A 15: 76,002,075 T1138S possibly damaging Het
Fzd4 T C 7: 89,407,704 W320R probably damaging Het
Gimap7 A T 6: 48,724,326 K282M probably benign Het
Gm13212 C G 4: 145,622,586 Q198E possibly damaging Het
Gnai2 G A 9: 107,615,714 T330I Het
Gpr107 T C 2: 31,188,716 S388P possibly damaging Het
Il1a T G 2: 129,300,734 M264L probably benign Het
Ints10 A T 8: 68,827,299 I693F probably damaging Het
Jak3 A T 8: 71,681,621 N456Y probably benign Het
Krcc1 A G 6: 71,284,473 E163G probably benign Het
Lctl A G 9: 64,133,173 Y466C probably damaging Het
Lrp12 A T 15: 39,877,961 S472T probably damaging Het
Lrp1b A G 2: 41,445,099 probably null Het
Lrriq1 T A 10: 103,221,283 M219L probably benign Het
Mbl2 T A 19: 30,239,341 D184E probably damaging Het
Mrgpra9 G A 7: 47,235,644 R92C probably benign Het
Mroh4 G A 15: 74,611,556 T644I probably damaging Het
Muc5ac C T 7: 141,815,518 A3114V probably benign Het
Myh11 T A 16: 14,211,288 M1197L Het
Naga C T 15: 82,336,883 G71S probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nsd3 A G 8: 25,709,061 probably null Het
Nsun6 T C 2: 15,042,237 T101A probably benign Het
Olfr545 T A 7: 102,494,877 probably benign Het
Pabpc4l T A 3: 46,446,891 D106V probably damaging Het
Pdlim5 G A 3: 142,247,348 P529L probably damaging Het
Ralgapa1 A G 12: 55,709,058 L1111P possibly damaging Het
Rangap1 T C 15: 81,722,020 D40G probably benign Het
Ripor2 T C 13: 24,731,680 F1078L probably damaging Het
Ryr3 T C 2: 112,779,991 D2312G probably damaging Het
Siglecg T A 7: 43,409,429 I202N probably benign Het
Slco4c1 G T 1: 96,867,919 S138* probably null Het
Snx27 T C 3: 94,524,286 Y267C probably damaging Het
Sphk2 C T 7: 45,711,755 R275H probably damaging Het
Stk36 T A 1: 74,616,634 V432E possibly damaging Het
Tecrl C T 5: 83,280,575 S283N possibly damaging Het
Tmem59l A G 8: 70,485,172 V186A possibly damaging Het
Try4 T C 6: 41,305,074 probably null Het
Ubr1 C A 2: 120,896,519 G1248V probably benign Het
Umod C T 7: 119,466,132 G558E probably damaging Het
Unc13b T C 4: 43,171,044 F624S unknown Het
Uvssa T G 5: 33,390,021 D310E probably benign Het
Vmn1r222 A T 13: 23,232,248 M265K probably benign Het
Vmn1r3 A G 4: 3,185,284 F8L probably benign Het
Zfp386 T A 12: 116,059,897 C412S probably damaging Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
browser UTSW 11 36046765 critical splice donor site probably null
mosaic UTSW 11 36063775 critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 36063902 missense probably damaging 0.99
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1579:Tenm2 UTSW 11 36106783 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4367:Tenm2 UTSW 11 36027398 missense probably benign
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4669:Tenm2 UTSW 11 36010487 missense probably damaging 1.00
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36207080 missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R5707:Tenm2 UTSW 11 36047182 missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6063:Tenm2 UTSW 11 36163717 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6885:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36171409 missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36163817 missense probably damaging 0.99
R7153:Tenm2 UTSW 11 36024182 missense probably damaging 0.98
R7173:Tenm2 UTSW 11 36041551 missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36171436 missense probably damaging 1.00
R7205:Tenm2 UTSW 11 36049129 missense probably damaging 0.99
R7250:Tenm2 UTSW 11 36072798 missense probably damaging 1.00
R7290:Tenm2 UTSW 11 36023471 missense probably damaging 1.00
R7366:Tenm2 UTSW 11 36069414 missense probably benign 0.09
R7432:Tenm2 UTSW 11 36864941 missense probably benign
R7504:Tenm2 UTSW 11 36139743 missense probably damaging 1.00
R7513:Tenm2 UTSW 11 36051900 missense probably benign 0.34
R7523:Tenm2 UTSW 11 36078581 splice site probably null
R7527:Tenm2 UTSW 11 36206976 missense probably damaging 1.00
R7648:Tenm2 UTSW 11 36106736 missense probably damaging 1.00
R7653:Tenm2 UTSW 11 36047347 missense probably benign 0.09
R7717:Tenm2 UTSW 11 36864935 missense probably damaging 0.97
R7739:Tenm2 UTSW 11 36069561 missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 36023306 missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 36010449 missense probably damaging 0.99
R7803:Tenm2 UTSW 11 36047116 missense probably damaging 0.98
R7834:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R7838:Tenm2 UTSW 11 36106799 missense probably benign 0.02
R8073:Tenm2 UTSW 11 36139644 missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 36027221 missense probably benign 0.23
R8109:Tenm2 UTSW 11 36008310 missense probably benign
R8306:Tenm2 UTSW 11 36069369 missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8452:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8864:Tenm2 UTSW 11 36027195 missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 36051961 missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36944034 missense probably damaging 0.98
R8969:Tenm2 UTSW 11 36051861 missense probably damaging 0.99
R9168:Tenm2 UTSW 11 36039895 missense probably damaging 1.00
R9279:Tenm2 UTSW 11 36068476 missense probably benign 0.00
R9294:Tenm2 UTSW 11 36024500 missense probably damaging 0.98
R9373:Tenm2 UTSW 11 36039886 missense probably damaging 1.00
R9408:Tenm2 UTSW 11 36069419 missense probably damaging 1.00
R9410:Tenm2 UTSW 11 36141569 missense probably damaging 0.99
R9454:Tenm2 UTSW 11 36221459 missense probably benign
RF021:Tenm2 UTSW 11 36024203 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36008234 missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36300335 missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 36385130 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCAGCACGTCATAATCACG -3'
(R):5'- TACAACAAGGCCAGCGGATG -3'

Sequencing Primer
(F):5'- CGTCATAATCACGTTGAGTAAAGTGG -3'
(R):5'- TGCAGTACCGCTATGACGGAG -3'
Posted On 2022-03-25