Incidental Mutation 'R9321:Kcnb2'
ID 706179
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms 9630047L19Rik, Kv2.2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9321 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 15287254-15723750 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15709569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 222 (D222N)
Ref Sequence ENSEMBL: ENSMUSP00000126656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect possibly damaging
Transcript: ENSMUST00000170146
AA Change: D222N

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000175681
AA Change: D222N

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: D222N

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,649 I248V possibly damaging Het
Abca13 A G 11: 9,510,475 S4162G probably benign Het
Acvr2b T C 9: 119,428,285 I152T probably benign Het
Adam15 T A 3: 89,347,487 probably null Het
Adam34 C T 8: 43,652,206 G134D probably damaging Het
Aifm2 C T 10: 61,735,631 Q315* probably null Het
Akap10 A G 11: 61,900,409 F408S probably damaging Het
Ap3b2 T C 7: 81,464,504 probably null Het
Btbd2 A C 10: 80,647,841 V181G probably damaging Het
Carmil3 G T 14: 55,503,968 G1070V Het
Ccdc144b A T 3: 36,018,990 V381E probably damaging Het
Ceacam2 G T 7: 25,530,664 D172E possibly damaging Het
Crtc3 G A 7: 80,609,902 A203V probably benign Het
Dclre1a A G 19: 56,542,668 S749P probably damaging Het
Dnah2 C T 11: 69,448,113 probably null Het
Eif2ak4 G A 2: 118,462,317 V1341M possibly damaging Het
Enpp5 T C 17: 44,082,798 V295A possibly damaging Het
Gm1110 T A 9: 26,920,595 M87L probably benign Het
H2-Ab1 T C 17: 34,267,995 L241P probably damaging Het
Hmx2 A G 7: 131,555,591 T145A probably benign Het
Itpripl1 T C 2: 127,142,080 S41G probably benign Het
Ldb3 C A 14: 34,544,142 G499* probably null Het
Lig1 T C 7: 13,301,009 F577S probably damaging Het
Lnx1 T C 5: 74,620,330 I177V probably damaging Het
Mark4 G T 7: 19,436,976 T323K probably benign Het
Mroh5 A G 15: 73,789,264 V301A probably benign Het
Mrvi1 A G 7: 110,925,327 S138P probably benign Het
Mtx3 T A 13: 92,847,589 W125R probably damaging Het
Myo18a G A 11: 77,842,544 G1404R probably damaging Het
Myom2 C T 8: 15,122,464 P1188S possibly damaging Het
Nars C T 18: 64,504,879 E335K probably damaging Het
Nfya A T 17: 48,400,466 V16E unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Nme5 T G 18: 34,571,544 I83L probably benign Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nptx1 A G 11: 119,547,552 L13P unknown Het
Olfr1052 A T 2: 86,297,953 I46F probably benign Het
Olfr1294 A G 2: 111,538,089 S67P probably damaging Het
Olfr213 T C 6: 116,541,409 Y319H probably benign Het
Olfr272 G T 4: 52,911,314 T160N probably damaging Het
Olfr451-ps1 T A 6: 42,800,858 V39D possibly damaging Het
Olfr743 G A 14: 50,534,014 V201I probably benign Het
Pdzd2 T C 15: 12,385,937 T916A probably benign Het
Plekha6 A G 1: 133,281,811 N615S probably damaging Het
Rad52 T C 6: 119,913,008 Y32H probably damaging Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Slx4 A G 16: 3,986,790 M720T probably benign Het
Spem1 T C 11: 69,821,835 H58R probably benign Het
Spg7 C A 8: 123,076,949 D239E probably benign Het
Tas2r123 A T 6: 132,848,132 M331L probably benign Het
Tcaf1 T C 6: 42,679,356 T229A probably benign Het
Tdrd1 T C 19: 56,860,335 L939P probably damaging Het
Timd2 T C 11: 46,687,089 T72A probably benign Het
Tmem179 G T 12: 112,510,956 N31K probably damaging Het
Tpd52l1 T C 10: 31,338,193 S165G Het
Tubgcp6 T C 15: 89,107,983 T600A probably damaging Het
Txlna T A 4: 129,634,453 E230D probably damaging Het
Ush2a A T 1: 188,356,951 I368F probably damaging Het
Vmn1r76 A T 7: 11,931,167 M40K possibly damaging Het
Zfp592 C T 7: 81,041,478 S1135L possibly damaging Het
Zfp606 A G 7: 12,492,683 T244A possibly damaging Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15709567 missense probably benign
R3025:Kcnb2 UTSW 1 15710835 missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15710415 missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15710256 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15709807 missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15710613 missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15312780 missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15711627 makesense probably null
R8156:Kcnb2 UTSW 1 15710056 missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15711553 missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15312710 missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15710652 missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15710424 missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15711499 missense probably benign
R9563:Kcnb2 UTSW 1 15709513 missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15711220 missense probably benign
R9709:Kcnb2 UTSW 1 15710299 missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Z1177:Kcnb2 UTSW 1 15710958 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCGTGTTCTCTATCATTCAAAGAAC -3'
(R):5'- ATTCTGGAACTGCAGCACAC -3'

Sequencing Primer
(F):5'- CCACCAAAGCATGTGTGGTTG -3'
(R):5'- GGAACTGCAGCACACTTTTG -3'
Posted On 2022-04-18