Incidental Mutation 'R9321:Enpp5'
ID 706236
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms D17Abb1e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9321 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 44078813-44086567 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44082798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 295 (V295A)
Ref Sequence ENSEMBL: ENSMUSP00000024756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
AlphaFold Q9EQG7
Predicted Effect possibly damaging
Transcript: ENSMUST00000024756
AA Change: V295A

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: V295A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect possibly damaging
Transcript: ENSMUST00000154166
AA Change: V295A

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: V295A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,649 I248V possibly damaging Het
Abca13 A G 11: 9,510,475 S4162G probably benign Het
Acvr2b T C 9: 119,428,285 I152T probably benign Het
Adam15 T A 3: 89,347,487 probably null Het
Adam34 C T 8: 43,652,206 G134D probably damaging Het
Aifm2 C T 10: 61,735,631 Q315* probably null Het
Akap10 A G 11: 61,900,409 F408S probably damaging Het
Ap3b2 T C 7: 81,464,504 probably null Het
Btbd2 A C 10: 80,647,841 V181G probably damaging Het
Carmil3 G T 14: 55,503,968 G1070V Het
Ccdc144b A T 3: 36,018,990 V381E probably damaging Het
Ceacam2 G T 7: 25,530,664 D172E possibly damaging Het
Crtc3 G A 7: 80,609,902 A203V probably benign Het
Dclre1a A G 19: 56,542,668 S749P probably damaging Het
Dnah2 C T 11: 69,448,113 probably null Het
Eif2ak4 G A 2: 118,462,317 V1341M possibly damaging Het
Gm1110 T A 9: 26,920,595 M87L probably benign Het
H2-Ab1 T C 17: 34,267,995 L241P probably damaging Het
Hmx2 A G 7: 131,555,591 T145A probably benign Het
Itpripl1 T C 2: 127,142,080 S41G probably benign Het
Kcnb2 G A 1: 15,709,569 D222N possibly damaging Het
Ldb3 C A 14: 34,544,142 G499* probably null Het
Lig1 T C 7: 13,301,009 F577S probably damaging Het
Lnx1 T C 5: 74,620,330 I177V probably damaging Het
Mark4 G T 7: 19,436,976 T323K probably benign Het
Mroh5 A G 15: 73,789,264 V301A probably benign Het
Mrvi1 A G 7: 110,925,327 S138P probably benign Het
Mtx3 T A 13: 92,847,589 W125R probably damaging Het
Myo18a G A 11: 77,842,544 G1404R probably damaging Het
Myom2 C T 8: 15,122,464 P1188S possibly damaging Het
Nars C T 18: 64,504,879 E335K probably damaging Het
Nfya A T 17: 48,400,466 V16E unknown Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Nme5 T G 18: 34,571,544 I83L probably benign Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nptx1 A G 11: 119,547,552 L13P unknown Het
Olfr1052 A T 2: 86,297,953 I46F probably benign Het
Olfr1294 A G 2: 111,538,089 S67P probably damaging Het
Olfr213 T C 6: 116,541,409 Y319H probably benign Het
Olfr272 G T 4: 52,911,314 T160N probably damaging Het
Olfr451-ps1 T A 6: 42,800,858 V39D possibly damaging Het
Olfr743 G A 14: 50,534,014 V201I probably benign Het
Pdzd2 T C 15: 12,385,937 T916A probably benign Het
Plekha6 A G 1: 133,281,811 N615S probably damaging Het
Rad52 T C 6: 119,913,008 Y32H probably damaging Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Slx4 A G 16: 3,986,790 M720T probably benign Het
Spem1 T C 11: 69,821,835 H58R probably benign Het
Spg7 C A 8: 123,076,949 D239E probably benign Het
Tas2r123 A T 6: 132,848,132 M331L probably benign Het
Tcaf1 T C 6: 42,679,356 T229A probably benign Het
Tdrd1 T C 19: 56,860,335 L939P probably damaging Het
Timd2 T C 11: 46,687,089 T72A probably benign Het
Tmem179 G T 12: 112,510,956 N31K probably damaging Het
Tpd52l1 T C 10: 31,338,193 S165G Het
Tubgcp6 T C 15: 89,107,983 T600A probably damaging Het
Txlna T A 4: 129,634,453 E230D probably damaging Het
Ush2a A T 1: 188,356,951 I368F probably damaging Het
Vmn1r76 A T 7: 11,931,167 M40K possibly damaging Het
Zfp592 C T 7: 81,041,478 S1135L possibly damaging Het
Zfp606 A G 7: 12,492,683 T244A possibly damaging Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6160:Enpp5 UTSW 17 44081368 missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R8211:Enpp5 UTSW 17 44081511 critical splice donor site probably null
R9256:Enpp5 UTSW 17 44085523 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCTTAGTGTTGAGGTGGC -3'
(R):5'- CCAAGTTAGCAAGAAACGGTGC -3'

Sequencing Primer
(F):5'- AAGTCTTTAGAGAGTATCGAGTACAG -3'
(R):5'- TTAGCAAGAAACGGTGCAGAATTG -3'
Posted On 2022-04-18