Incidental Mutation 'R0739:Olfr486'
ID 70624
Institutional Source Beutler Lab
Gene Symbol Olfr486
Ensembl Gene ENSMUSG00000096068
Gene Name olfactory receptor 486
Synonyms MOR204-19, GA_x6K02T2PBJ9-10501920-10500976
MMRRC Submission 038920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0739 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 108171798-108172742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108172010 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000071918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072035]
AlphaFold Q8VFD0
Predicted Effect probably benign
Transcript: ENSMUST00000072035
AA Change: T245A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071918
Gene: ENSMUSG00000096068
AA Change: T245A

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 6.8e-51 PFAM
Pfam:7tm_1 44 293 6.6e-24 PFAM
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Axdnd1 T C 1: 156,380,886 N396D possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Ccr8 G A 9: 120,094,349 G177S probably damaging Het
Clmn C T 12: 104,781,017 G757D possibly damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Elovl4 A G 9: 83,785,109 F65S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Klf11 T C 12: 24,660,248 S432P probably damaging Het
Neo1 C T 9: 58,921,877 A580T probably benign Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Olfr486
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Olfr486 UTSW 7 108171927 missense probably benign 0.09
R0144:Olfr486 UTSW 7 108171971 missense probably benign 0.00
R0165:Olfr486 UTSW 7 108172675 missense probably benign 0.03
R1027:Olfr486 UTSW 7 108172141 missense probably damaging 0.98
R1781:Olfr486 UTSW 7 108171883 missense probably benign 0.06
R3729:Olfr486 UTSW 7 108172309 missense probably benign 0.13
R4505:Olfr486 UTSW 7 108171968 missense probably benign 0.00
R5223:Olfr486 UTSW 7 108172708 missense probably benign 0.20
R7089:Olfr486 UTSW 7 108172494 missense probably benign 0.01
R7499:Olfr486 UTSW 7 108171800 makesense probably null
R7894:Olfr486 UTSW 7 108172184 missense probably benign
R7995:Olfr486 UTSW 7 108172000 missense probably damaging 1.00
R8807:Olfr486 UTSW 7 108172645 missense possibly damaging 0.93
R9050:Olfr486 UTSW 7 108171880 missense probably damaging 1.00
R9244:Olfr486 UTSW 7 108172645 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCTGTAGATGAGGGGATTCAACAC -3'
(R):5'- CCACTTGGCTTCTGTTGATATGGGC -3'

Sequencing Primer
(F):5'- TTCAACACGGGGATTACCAG -3'
(R):5'- GCTTGGTAGCAATCTGCAAC -3'
Posted On 2013-09-30