Incidental Mutation 'R9322:Pik3r2'
ID 706268
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Name phosphoinositide-3-kinase regulatory subunit 2
Synonyms p85beta
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70768176-70776713 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70774850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 43 (V43A)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold O08908
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034296
AA Change: V43A

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: V43A

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166004
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211948
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,301,505 V727A probably damaging Het
Arhgef33 T A 17: 80,370,389 L455* probably null Het
Arnt T C 3: 95,490,618 S591P probably benign Het
Asic4 A G 1: 75,469,818 M335V probably benign Het
Atp1a2 A G 1: 172,280,058 S665P possibly damaging Het
Cat T C 2: 103,472,988 N148S probably damaging Het
Ccdc9 T C 7: 16,278,435 D274G probably damaging Het
Csnk1g2 T C 10: 80,639,144 Y332H probably damaging Het
Csrnp1 T C 9: 119,972,787 E402G probably damaging Het
Dchs2 T A 3: 83,281,694 I1455N possibly damaging Het
Dnah12 A T 14: 26,770,977 I1232F possibly damaging Het
Dsn1 C T 2: 157,001,749 V144I possibly damaging Het
Epha6 A T 16: 60,424,755 S360R probably damaging Het
Fasl A T 1: 161,781,943 L158Q probably damaging Het
Filip1 A T 9: 79,819,732 V535E probably benign Het
Fmo5 A T 3: 97,638,874 K168* probably null Het
Gm11639 A T 11: 104,874,373 E2501V probably benign Het
Gm5157 T G 7: 21,185,506 K37N probably benign Het
Gm6583 T A 5: 112,355,406 Y144F probably damaging Het
Grm8 T A 6: 27,363,729 I596F possibly damaging Het
Il23a T C 10: 128,297,121 E123G probably benign Het
Itpr2 T C 6: 146,325,089 T1386A probably benign Het
Krt79 T A 15: 101,931,810 Q317L possibly damaging Het
Lhx4 A G 1: 155,702,607 I263T probably benign Het
Med4 T C 14: 73,510,161 L34P probably damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mief2 A T 11: 60,731,018 H138L possibly damaging Het
Narfl G C 17: 25,779,574 Q217H probably damaging Het
Nat3 A T 8: 67,547,510 K14* probably null Het
Nbeal1 T A 1: 60,258,659 I1216N possibly damaging Het
Nlrp1b T C 11: 71,217,292 E461G probably benign Het
Olfr259 T C 2: 87,108,217 T57A probably damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr748 C A 14: 50,711,050 T240N probably damaging Het
Pdha2 C A 3: 141,210,789 M319I probably benign Het
Psd T A 19: 46,313,441 E902V probably damaging Het
Psme3 A C 11: 101,320,611 H198P probably damaging Het
Rlbp1 T C 7: 79,377,255 D219G possibly damaging Het
Scn1b C A 7: 31,125,092 W57L probably damaging Het
Sfrp2 T C 3: 83,766,699 I53T probably damaging Het
Skiv2l T C 17: 34,847,463 probably null Het
Slc18a3 A G 14: 32,463,325 I367T probably benign Het
Slc44a2 A T 9: 21,346,950 R499W probably damaging Het
St18 A G 1: 6,795,523 D75G probably benign Het
Trim67 C A 8: 124,823,228 Y532* probably null Het
Ttc16 C T 2: 32,774,940 probably benign Het
Usp7 A T 16: 8,699,260 S487T probably damaging Het
Vmn2r104 T C 17: 20,042,825 T125A probably benign Het
Vmn2r70 T C 7: 85,559,290 T660A possibly damaging Het
Zer1 A T 2: 30,110,911 V166D probably benign Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70770429 missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70772348 unclassified probably benign
IGL02514:Pik3r2 APN 8 70770592 missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70772355 missense probably benign
kingfisher UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70772044 unclassified probably benign
R1636:Pik3r2 UTSW 8 70771898 missense probably benign
R1662:Pik3r2 UTSW 8 70770606 missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70769385 missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70772385 missense probably benign
R3830:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70769986 missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70770421 missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70772136 nonsense probably null
R4666:Pik3r2 UTSW 8 70768859 missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 70769764 missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70772026 missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70772639 missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70769173 missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70770717 missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70770414 missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70769381 missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70770901 missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70769764 missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 70772367 missense probably benign 0.14
R8237:Pik3r2 UTSW 8 70772150 missense probably benign 0.00
R8414:Pik3r2 UTSW 8 70770435 missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 70774668 missense probably benign
R8781:Pik3r2 UTSW 8 70769402 missense possibly damaging 0.88
R8794:Pik3r2 UTSW 8 70771363 missense probably benign
R9401:Pik3r2 UTSW 8 70771093 missense possibly damaging 0.77
R9668:Pik3r2 UTSW 8 70768815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGATCCATCCAAGGGC -3'
(R):5'- TAGAGGTCTACAAGCCCACC -3'

Sequencing Primer
(F):5'- ATCCATCCAAGGGCCTGGC -3'
(R):5'- AGCCCATGGGGTCCCTAGAG -3'
Posted On 2022-04-18