Incidental Mutation 'R9322:Or11h23'
ID 706282
Institutional Source Beutler Lab
Gene Symbol Or11h23
Ensembl Gene ENSMUSG00000060084
Gene Name olfactory receptor family 11 subfamily G member 23
Synonyms GA_x6K02T2PMLR-6454789-6455712, Olfr748, MOR106-9P
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50947789-50948712 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 50948507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 240 (T240N)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
AlphaFold E9Q9Z0
Predicted Effect probably damaging
Transcript: ENSMUST00000073561
AA Change: T240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: T240N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213101
AA Change: T240N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,192,331 (GRCm39) V727A probably damaging Het
Arhgef33 T A 17: 80,677,818 (GRCm39) L455* probably null Het
Arnt T C 3: 95,397,929 (GRCm39) S591P probably benign Het
Asic4 A G 1: 75,446,462 (GRCm39) M335V probably benign Het
Atp1a2 A G 1: 172,107,625 (GRCm39) S665P possibly damaging Het
Cat T C 2: 103,303,333 (GRCm39) N148S probably damaging Het
Ccdc121rt3 T A 5: 112,503,272 (GRCm39) Y144F probably damaging Het
Ccdc9 T C 7: 16,012,360 (GRCm39) D274G probably damaging Het
Ciao3 G C 17: 25,998,548 (GRCm39) Q217H probably damaging Het
Csnk1g2 T C 10: 80,474,978 (GRCm39) Y332H probably damaging Het
Csrnp1 T C 9: 119,801,853 (GRCm39) E402G probably damaging Het
Dchs2 T A 3: 83,189,001 (GRCm39) I1455N possibly damaging Het
Dnah12 A T 14: 26,492,934 (GRCm39) I1232F possibly damaging Het
Dsn1 C T 2: 156,843,669 (GRCm39) V144I possibly damaging Het
Efcab3 A T 11: 104,765,199 (GRCm39) E2501V probably benign Het
Epha6 A T 16: 60,245,118 (GRCm39) S360R probably damaging Het
Fasl A T 1: 161,609,512 (GRCm39) L158Q probably damaging Het
Filip1 A T 9: 79,727,014 (GRCm39) V535E probably benign Het
Fmo5 A T 3: 97,546,190 (GRCm39) K168* probably null Het
Gm5157 T G 7: 20,919,431 (GRCm39) K37N probably benign Het
Grm8 T A 6: 27,363,728 (GRCm39) I596F possibly damaging Het
Il23a T C 10: 128,132,990 (GRCm39) E123G probably benign Het
Itpr2 T C 6: 146,226,587 (GRCm39) T1386A probably benign Het
Krt79 T A 15: 101,840,245 (GRCm39) Q317L possibly damaging Het
Lhx4 A G 1: 155,578,353 (GRCm39) I263T probably benign Het
Med4 T C 14: 73,747,601 (GRCm39) L34P probably damaging Het
Mid1 C G X: 168,768,003 (GRCm39) P384A probably benign Het
Mief2 A T 11: 60,621,844 (GRCm39) H138L possibly damaging Het
Nat3 A T 8: 68,000,162 (GRCm39) K14* probably null Het
Nbeal1 T A 1: 60,297,818 (GRCm39) I1216N possibly damaging Het
Nlrp1b T C 11: 71,108,118 (GRCm39) E461G probably benign Het
Or5aq7 T C 2: 86,938,561 (GRCm39) T57A probably damaging Het
Or5p4 C T 7: 107,680,727 (GRCm39) T242M probably damaging Het
Pdha2 C A 3: 140,916,550 (GRCm39) M319I probably benign Het
Pik3r2 A G 8: 71,227,494 (GRCm39) V43A possibly damaging Het
Psd T A 19: 46,301,880 (GRCm39) E902V probably damaging Het
Psme3 A C 11: 101,211,437 (GRCm39) H198P probably damaging Het
Rlbp1 T C 7: 79,027,003 (GRCm39) D219G possibly damaging Het
Scn1b C A 7: 30,824,517 (GRCm39) W57L probably damaging Het
Sfrp2 T C 3: 83,674,006 (GRCm39) I53T probably damaging Het
Skic2 T C 17: 35,066,439 (GRCm39) probably null Het
Slc18a3 A G 14: 32,185,282 (GRCm39) I367T probably benign Het
Slc44a2 A T 9: 21,258,246 (GRCm39) R499W probably damaging Het
St18 A G 1: 6,865,747 (GRCm39) D75G probably benign Het
Trim67 C A 8: 125,549,967 (GRCm39) Y532* probably null Het
Ttc16 C T 2: 32,664,952 (GRCm39) probably benign Het
Usp7 A T 16: 8,517,124 (GRCm39) S487T probably damaging Het
Vmn2r104 T C 17: 20,263,087 (GRCm39) T125A probably benign Het
Vmn2r70 T C 7: 85,208,498 (GRCm39) T660A possibly damaging Het
Zer1 A T 2: 30,000,923 (GRCm39) V166D probably benign Het
Other mutations in Or11h23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Or11h23 APN 14 50,948,450 (GRCm39) missense possibly damaging 0.95
IGL02965:Or11h23 APN 14 50,948,653 (GRCm39) missense probably damaging 1.00
R0576:Or11h23 UTSW 14 50,948,661 (GRCm39) missense probably damaging 0.98
R1184:Or11h23 UTSW 14 50,948,071 (GRCm39) missense probably benign 0.01
R2129:Or11h23 UTSW 14 50,948,093 (GRCm39) missense probably damaging 0.99
R2895:Or11h23 UTSW 14 50,947,973 (GRCm39) missense probably damaging 0.99
R2896:Or11h23 UTSW 14 50,947,973 (GRCm39) missense probably damaging 0.99
R4017:Or11h23 UTSW 14 50,948,333 (GRCm39) missense probably benign 0.03
R5053:Or11h23 UTSW 14 50,947,968 (GRCm39) nonsense probably null
R5057:Or11h23 UTSW 14 50,948,669 (GRCm39) missense probably damaging 1.00
R5113:Or11h23 UTSW 14 50,948,371 (GRCm39) missense probably benign 0.00
R5294:Or11h23 UTSW 14 50,948,236 (GRCm39) missense probably benign 0.01
R5294:Or11h23 UTSW 14 50,947,900 (GRCm39) missense possibly damaging 0.95
R5499:Or11h23 UTSW 14 50,948,324 (GRCm39) missense probably damaging 1.00
R5582:Or11h23 UTSW 14 50,948,425 (GRCm39) missense probably damaging 1.00
R5727:Or11h23 UTSW 14 50,947,817 (GRCm39) missense possibly damaging 0.74
R6797:Or11h23 UTSW 14 50,948,563 (GRCm39) missense probably damaging 1.00
R7685:Or11h23 UTSW 14 50,948,215 (GRCm39) missense possibly damaging 0.95
R7717:Or11h23 UTSW 14 50,948,219 (GRCm39) missense probably damaging 1.00
R7778:Or11h23 UTSW 14 50,947,928 (GRCm39) missense possibly damaging 0.60
R8276:Or11h23 UTSW 14 50,948,287 (GRCm39) missense probably benign 0.28
R8839:Or11h23 UTSW 14 50,947,957 (GRCm39) missense possibly damaging 0.73
R9358:Or11h23 UTSW 14 50,947,802 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGACCCACTAATGGTCCTG -3'
(R):5'- GTGTCCCATAGTCAGGTAATAAAACC -3'

Sequencing Primer
(F):5'- GACCCACTAATGGTCCTGTCCTG -3'
(R):5'- ATGGAGGGCATATTTCATATCCTTG -3'
Posted On 2022-04-18