Incidental Mutation 'R9322:Epha6'
ID 706286
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9322 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60424755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 360 (S360R)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: S360R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: S360R

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,301,505 V727A probably damaging Het
Arhgef33 T A 17: 80,370,389 L455* probably null Het
Arnt T C 3: 95,490,618 S591P probably benign Het
Asic4 A G 1: 75,469,818 M335V probably benign Het
Atp1a2 A G 1: 172,280,058 S665P possibly damaging Het
Cat T C 2: 103,472,988 N148S probably damaging Het
Ccdc9 T C 7: 16,278,435 D274G probably damaging Het
Csnk1g2 T C 10: 80,639,144 Y332H probably damaging Het
Csrnp1 T C 9: 119,972,787 E402G probably damaging Het
Dchs2 T A 3: 83,281,694 I1455N possibly damaging Het
Dnah12 A T 14: 26,770,977 I1232F possibly damaging Het
Dsn1 C T 2: 157,001,749 V144I possibly damaging Het
Fasl A T 1: 161,781,943 L158Q probably damaging Het
Filip1 A T 9: 79,819,732 V535E probably benign Het
Fmo5 A T 3: 97,638,874 K168* probably null Het
Gm11639 A T 11: 104,874,373 E2501V probably benign Het
Gm5157 T G 7: 21,185,506 K37N probably benign Het
Gm6583 T A 5: 112,355,406 Y144F probably damaging Het
Grm8 T A 6: 27,363,729 I596F possibly damaging Het
Il23a T C 10: 128,297,121 E123G probably benign Het
Itpr2 T C 6: 146,325,089 T1386A probably benign Het
Krt79 T A 15: 101,931,810 Q317L possibly damaging Het
Lhx4 A G 1: 155,702,607 I263T probably benign Het
Med4 T C 14: 73,510,161 L34P probably damaging Het
Mid1 C G X: 169,985,007 P384A probably benign Het
Mief2 A T 11: 60,731,018 H138L possibly damaging Het
Narfl G C 17: 25,779,574 Q217H probably damaging Het
Nat3 A T 8: 67,547,510 K14* probably null Het
Nbeal1 T A 1: 60,258,659 I1216N possibly damaging Het
Nlrp1b T C 11: 71,217,292 E461G probably benign Het
Olfr259 T C 2: 87,108,217 T57A probably damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr748 C A 14: 50,711,050 T240N probably damaging Het
Pdha2 C A 3: 141,210,789 M319I probably benign Het
Pik3r2 A G 8: 70,774,850 V43A possibly damaging Het
Psd T A 19: 46,313,441 E902V probably damaging Het
Psme3 A C 11: 101,320,611 H198P probably damaging Het
Rlbp1 T C 7: 79,377,255 D219G possibly damaging Het
Scn1b C A 7: 31,125,092 W57L probably damaging Het
Sfrp2 T C 3: 83,766,699 I53T probably damaging Het
Skiv2l T C 17: 34,847,463 probably null Het
Slc18a3 A G 14: 32,463,325 I367T probably benign Het
Slc44a2 A T 9: 21,346,950 R499W probably damaging Het
St18 A G 1: 6,795,523 D75G probably benign Het
Trim67 C A 8: 124,823,228 Y532* probably null Het
Ttc16 C T 2: 32,774,940 probably benign Het
Usp7 A T 16: 8,699,260 S487T probably damaging Het
Vmn2r104 T C 17: 20,042,825 T125A probably benign Het
Vmn2r70 T C 7: 85,559,290 T660A possibly damaging Het
Zer1 A T 2: 30,110,911 V166D probably benign Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9442:Epha6 UTSW 16 60205487 missense probably benign 0.26
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCTTGACGTTGTTTTC -3'
(R):5'- AAAATGCCCCTTCACCGTG -3'

Sequencing Primer
(F):5'- TGAGGAAGCACAGTAGCAT -3'
(R):5'- TTCACCGTGCGGAACTTG -3'
Posted On 2022-04-18