Incidental Mutation 'R0739:Ccr8'
ID 70629
Institutional Source Beutler Lab
Gene Symbol Ccr8
Ensembl Gene ENSMUSG00000042262
Gene Name chemokine (C-C motif) receptor 8
Synonyms Cmkbr8
MMRRC Submission 038920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0739 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 120092114-120094906 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120094349 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 177 (G177S)
Ref Sequence ENSEMBL: ENSMUSP00000038473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048777]
AlphaFold P56484
Predicted Effect probably damaging
Transcript: ENSMUST00000048777
AA Change: G177S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: G177S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 313 2.4e-8 PFAM
Pfam:7tm_1 50 298 3.3e-44 PFAM
low complexity region 338 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217495
Meta Mutation Damage Score 0.2089 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Axdnd1 T C 1: 156,380,886 N396D possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Clmn C T 12: 104,781,017 G757D possibly damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Elovl4 A G 9: 83,785,109 F65S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Klf11 T C 12: 24,660,248 S432P probably damaging Het
Neo1 C T 9: 58,921,877 A580T probably benign Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr486 T C 7: 108,172,010 T245A probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Ccr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Ccr8 APN 9 120094625 missense probably damaging 1.00
IGL02558:Ccr8 APN 9 120094658 missense probably benign 0.01
IGL02966:Ccr8 APN 9 120094140 missense probably damaging 0.96
IGL03135:Ccr8 APN 9 120094623 missense possibly damaging 0.89
R0402:Ccr8 UTSW 9 120094910 splice site probably null
R1069:Ccr8 UTSW 9 120094217 missense probably benign 0.00
R4766:Ccr8 UTSW 9 120094464 missense probably damaging 1.00
R4934:Ccr8 UTSW 9 120094749 missense probably benign
R5116:Ccr8 UTSW 9 120094029 missense probably benign 0.39
R5942:Ccr8 UTSW 9 120094706 missense probably damaging 0.99
R5957:Ccr8 UTSW 9 120093827 missense probably damaging 0.99
R5996:Ccr8 UTSW 9 120094463 missense probably damaging 1.00
R7223:Ccr8 UTSW 9 120094617 missense probably damaging 0.99
R8037:Ccr8 UTSW 9 120094370 missense probably benign
R8332:Ccr8 UTSW 9 120094374 missense probably damaging 1.00
R8962:Ccr8 UTSW 9 120094547 missense possibly damaging 0.56
R9344:Ccr8 UTSW 9 120094067 missense probably damaging 1.00
Z1177:Ccr8 UTSW 9 120094499 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TTTCAGACCCACAACCTGCTGGAC -3'
(R):5'- AAGACACAATGACTACGGTGAGCAC -3'

Sequencing Primer
(F):5'- CAGCAGTATGTTCTTCATCACC -3'
(R):5'- TGAGCACCAGCTTGATGG -3'
Posted On 2013-09-30