Mutagenetix > Incidental Mutation

Incidental Mutation 'R0739:Ccr8'

70629

Institutional Source

Beutler Lab

Gene Symbol

Ccr8

Ensembl Gene

ENSMUSG00000042262

Gene Name

C-C motif chemokine receptor 8

Synonyms

Cmkbr8

MMRRC Submission

038920-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0739 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119921199-119923972 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119923415 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 177 (G177S)

Ref Sequence

ENSEMBL: ENSMUSP00000038473 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048777]

AlphaFold

P56484

Predicted Effect

probably damaging
Transcript: ENSMUST00000048777
AA Change: G177S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: G177S

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	44	313	2.4e-8	PFAM
Pfam:7tm_1	50	298	3.3e-44	PFAM
low complexity region	338	347	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217495

Meta Mutation Damage Score

0.2089

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 95.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	A	G	11: 54,227,961 (GRCm39)	E327G	probably damaging	Het
Adcy6	T	C	15: 98,496,260 (GRCm39)	D593G	probably benign	Het
Ankmy1	T	C	1: 92,816,370 (GRCm39)	D248G	probably damaging	Het
Atp2a1	T	C	7: 126,047,428 (GRCm39)	I743V	possibly damaging	Het
Axdnd1	T	C	1: 156,208,456 (GRCm39)	N396D	possibly damaging	Het
Cacna1e	C	T	1: 154,318,024 (GRCm39)	A1391T	probably damaging	Het
Clmn	C	T	12: 104,747,276 (GRCm39)	G757D	possibly damaging	Het
Cntn2	T	A	1: 132,456,750 (GRCm39)	I99F	probably damaging	Het
D6Ertd527e	C	G	6: 87,088,650 (GRCm39)	A271G	unknown	Het
Dnah1	A	T	14: 30,987,872 (GRCm39)	C3515*	probably null	Het
Eif2d	A	G	1: 131,082,100 (GRCm39)	Y64C	probably damaging	Het
Elovl4	A	G	9: 83,667,162 (GRCm39)	F65S	probably damaging	Het
F5	G	C	1: 164,026,486 (GRCm39)	R1686P	probably damaging	Het
Fbn1	T	C	2: 125,209,550 (GRCm39)	E938G	probably benign	Het
Foxn1	T	C	11: 78,249,825 (GRCm39)	T567A	probably benign	Het
Gabrr1	T	C	4: 33,162,781 (GRCm39)	M449T	probably benign	Het
Gdf2	C	T	14: 33,663,178 (GRCm39)	P24L	probably damaging	Het
Itgb3bp	T	C	4: 99,690,433 (GRCm39)	I29V	probably benign	Het
Kcnk7	C	T	19: 5,754,830 (GRCm39)		probably null	Het
Klf11	T	C	12: 24,710,247 (GRCm39)	S432P	probably damaging	Het
Neo1	C	T	9: 58,829,160 (GRCm39)	A580T	probably benign	Het
Nexmif	G	T	X: 103,128,555 (GRCm39)	Q1121K	probably benign	Het
Or51aa5	T	C	7: 103,166,931 (GRCm39)	Y220C	probably damaging	Het
Or51f5	T	C	7: 102,423,872 (GRCm39)	I47T	probably damaging	Het
Or5p62	T	C	7: 107,771,217 (GRCm39)	T245A	probably benign	Het
Osgepl1	G	T	1: 53,362,354 (GRCm39)	E399*	probably null	Het
Parvg	T	A	15: 84,215,222 (GRCm39)	V197E	probably damaging	Het
Pcyt2	A	G	11: 120,502,870 (GRCm39)	L257P	probably damaging	Het
Pou3f2	T	C	4: 22,486,960 (GRCm39)	D391G	possibly damaging	Het
Psmd2	C	T	16: 20,474,079 (GRCm39)	R261C	probably benign	Het
Ptpn13	T	C	5: 103,722,998 (GRCm39)	F1981L	probably benign	Het
Rbp3	A	T	14: 33,680,604 (GRCm39)	I1069F	probably benign	Het
Rhbdf2	A	T	11: 116,490,987 (GRCm39)	L655Q	probably damaging	Het
Sec16a	A	T	2: 26,331,063 (GRCm39)	N317K	possibly damaging	Het
Serpina3f	T	C	12: 104,184,612 (GRCm39)	V252A	probably damaging	Het
Slc22a23	C	T	13: 34,528,366 (GRCm39)	G139S	possibly damaging	Het
Smyd2	T	C	1: 189,621,059 (GRCm39)	T220A	possibly damaging	Het
Snrpb2	T	A	2: 142,907,281 (GRCm39)		probably benign	Het
Spopfm1	A	G	3: 94,173,102 (GRCm39)	M37V	probably benign	Het
Sptan1	A	T	2: 29,903,530 (GRCm39)	I1502F	probably damaging	Het
Srprb	A	T	9: 103,074,794 (GRCm39)	L116H	probably damaging	Het
Stradb	T	A	1: 59,016,174 (GRCm39)		probably benign	Het
Tm9sf4	C	A	2: 153,045,734 (GRCm39)	F535L	probably damaging	Het
Tmprss15	A	T	16: 78,821,736 (GRCm39)	S440T	possibly damaging	Het
Tpr	C	T	1: 150,283,248 (GRCm39)	A293V	possibly damaging	Het
Usp34	C	T	11: 23,417,243 (GRCm39)	T2964I	possibly damaging	Het
Usp35	C	A	7: 96,960,874 (GRCm39)	E851*	probably null	Het
Zc3h14	T	A	12: 98,723,460 (GRCm39)	V250D	probably damaging	Het
Zfp568	T	A	7: 29,722,746 (GRCm39)	C564S	probably damaging	Het

Other mutations in Ccr8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01511:Ccr8	APN	9	119,923,691 (GRCm39)	missense	probably damaging	1.00
IGL02558:Ccr8	APN	9	119,923,724 (GRCm39)	missense	probably benign	0.01
IGL02966:Ccr8	APN	9	119,923,206 (GRCm39)	missense	probably damaging	0.96
IGL03135:Ccr8	APN	9	119,923,689 (GRCm39)	missense	possibly damaging	0.89
R0402:Ccr8	UTSW	9	119,923,976 (GRCm39)	splice site	probably null
R1069:Ccr8	UTSW	9	119,923,283 (GRCm39)	missense	probably benign	0.00
R4766:Ccr8	UTSW	9	119,923,530 (GRCm39)	missense	probably damaging	1.00
R4934:Ccr8	UTSW	9	119,923,815 (GRCm39)	missense	probably benign
R5116:Ccr8	UTSW	9	119,923,095 (GRCm39)	missense	probably benign	0.39
R5942:Ccr8	UTSW	9	119,923,772 (GRCm39)	missense	probably damaging	0.99
R5957:Ccr8	UTSW	9	119,922,893 (GRCm39)	missense	probably damaging	0.99
R5996:Ccr8	UTSW	9	119,923,529 (GRCm39)	missense	probably damaging	1.00
R7223:Ccr8	UTSW	9	119,923,683 (GRCm39)	missense	probably damaging	0.99
R8037:Ccr8	UTSW	9	119,923,436 (GRCm39)	missense	probably benign
R8332:Ccr8	UTSW	9	119,923,440 (GRCm39)	missense	probably damaging	1.00
R8962:Ccr8	UTSW	9	119,923,613 (GRCm39)	missense	possibly damaging	0.56
R9344:Ccr8	UTSW	9	119,923,133 (GRCm39)	missense	probably damaging	1.00
Z1177:Ccr8	UTSW	9	119,923,565 (GRCm39)	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- TTTCAGACCCACAACCTGCTGGAC -3'
(R):5'- AAGACACAATGACTACGGTGAGCAC -3'

Sequencing Primer
(F):5'- CAGCAGTATGTTCTTCATCACC -3'
(R):5'- TGAGCACCAGCTTGATGG -3'

Posted On

2013-09-30