Incidental Mutation 'R9323:Atf6'
ID 706296
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms 9130025P16Rik, ESTM49, Atf6alpha
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R9323 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 170704674-170867771 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 170855113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 43 (Y43*)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably null
Transcript: ENSMUST00000027974
AA Change: Y43*
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: Y43*

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,718,413 S54P unknown Het
5430419D17Rik T A 7: 131,226,672 N285K probably damaging Het
Abat G A 16: 8,602,371 W178* probably null Het
Alx1 G A 10: 103,022,263 R192* probably null Het
Apom A G 17: 35,131,657 C23R probably damaging Het
Asap2 A G 12: 21,112,147 N35S probably benign Het
Bag4 T C 8: 25,771,333 S127G possibly damaging Het
Bag4 G T 8: 25,785,152 S7* probably null Het
Ccdc88b A G 19: 6,849,107 L1080P probably damaging Het
Cdkl2 A T 5: 92,020,248 D362E probably benign Het
Cep170 A G 1: 176,758,502 S575P probably benign Het
Col4a2 C T 8: 11,443,413 P1374L possibly damaging Het
Cpt2 T C 4: 107,904,359 H617R probably benign Het
Cyp2d22 A G 15: 82,374,006 S138P probably damaging Het
Cyp2j11 T C 4: 96,307,382 D359G probably benign Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Dmrtc2 A T 7: 24,872,916 I121F probably benign Het
Dus1l C T 11: 120,793,898 R149H probably damaging Het
Fam214a C T 9: 74,976,133 probably benign Het
Fam35a A G 14: 34,259,639 V514A probably damaging Het
Fam90a1a T A 8: 21,963,624 Y332N probably benign Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Grpel1 T A 5: 36,470,663 V96E possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Igkv4-80 C T 6: 69,016,767 A47T probably damaging Het
Il1a T A 2: 129,307,906 I25F probably benign Het
Ireb2 T A 9: 54,904,239 probably null Het
Itpr1 A G 6: 108,352,018 Y131C probably damaging Het
Kmt2a T C 9: 44,819,964 probably benign Het
Lancl1 T A 1: 67,038,635 probably benign Het
Lpl G A 8: 68,887,544 V64M possibly damaging Het
March10 T C 11: 105,389,755 H568R probably damaging Het
Mib1 G A 18: 10,775,685 V546M probably damaging Het
Mss51 A T 14: 20,484,871 I277N probably benign Het
Mybpc1 A G 10: 88,524,967 probably null Het
Myct1 A C 10: 5,604,195 I21L probably benign Het
Myo5c C A 9: 75,246,249 A139E probably damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Npy2r A T 3: 82,540,421 I349N possibly damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Olfr113 A C 17: 37,575,244 Y60D probably damaging Het
Olfr478 C T 7: 108,032,023 V107I probably benign Het
Olfr659 T C 7: 104,671,013 F104L possibly damaging Het
Olfr803 A T 10: 129,691,960 V27D probably benign Het
Olfr930 T C 9: 38,930,522 V117A probably benign Het
Olfr978 T C 9: 39,994,064 S85P possibly damaging Het
Pde6b A T 5: 108,403,432 N194I probably damaging Het
Polg TCTGGATGA TCTGGATGACTGGATGA 7: 79,465,031 probably null Het
Polg GA GACTGGAGCA 7: 79,465,038 probably null Het
Ptpn9 T C 9: 57,027,417 M155T possibly damaging Het
Ret A G 6: 118,182,014 Y146H probably benign Het
Sdf2l1 T C 16: 17,131,634 H116R probably damaging Het
Slc37a1 T C 17: 31,333,669 I316T probably damaging Het
Slc4a11 A C 2: 130,686,910 L473R possibly damaging Het
Smg7 A G 1: 152,856,002 M344T probably benign Het
Smg9 T C 7: 24,415,040 L268P probably damaging Het
Tiparp C T 3: 65,531,851 T196I probably benign Het
Trappc12 A G 12: 28,692,492 probably null Het
Trappc9 A T 15: 72,693,582 N953K probably benign Het
Trpa1 A G 1: 14,898,340 V428A probably benign Het
Utp20 T C 10: 88,747,308 R2728G probably damaging Het
Zfp612 A G 8: 110,088,740 E193G probably benign Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0455:Atf6 UTSW 1 170834923 missense probably benign 0.00
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R2164:Atf6 UTSW 1 170794735 missense probably damaging 1.00
R3782:Atf6 UTSW 1 170794767 nonsense probably null
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R4676:Atf6 UTSW 1 170787410 missense probably damaging 1.00
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841775 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8860:Atf6 UTSW 1 170852966 missense probably null 0.95
R8956:Atf6 UTSW 1 170794007 missense probably damaging 0.98
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9271:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9500:Atf6 UTSW 1 170747139 missense probably damaging 0.98
R9594:Atf6 UTSW 1 170840833 missense probably benign 0.18
R9733:Atf6 UTSW 1 170834833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATCTCTCTTATGGCAAACC -3'
(R):5'- GTTCACATTGCTTGAGCTTGTCAG -3'

Sequencing Primer
(F):5'- CAAGACCTGGACAATTTTATAGCTC -3'
(R):5'- TTGTCAGCAGCAGCAGTG -3'
Posted On 2022-04-18