Incidental Mutation 'R9323:Ret'
ID 706311
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R9323 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118158975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 146 (Y146H)
Ref Sequence ENSEMBL: ENSMUSP00000032201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
PDB Structure Crystal Structure of Dok1 PTB Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032201
AA Change: Y146H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: Y146H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088790
AA Change: Y146H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: Y146H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat G A 16: 8,420,235 (GRCm39) W178* probably null Het
Alx1 G A 10: 102,858,124 (GRCm39) R192* probably null Het
Apom A G 17: 35,350,633 (GRCm39) C23R probably damaging Het
Asap2 A G 12: 21,162,148 (GRCm39) N35S probably benign Het
Atf6 A T 1: 170,682,682 (GRCm39) Y43* probably null Het
Atosa C T 9: 74,883,415 (GRCm39) probably benign Het
Bag4 T C 8: 26,261,361 (GRCm39) S127G possibly damaging Het
Bag4 G T 8: 26,275,180 (GRCm39) S7* probably null Het
Ccdc88b A G 19: 6,826,475 (GRCm39) L1080P probably damaging Het
Cdcp3 T A 7: 130,828,401 (GRCm39) N285K probably damaging Het
Cdkl2 A T 5: 92,168,107 (GRCm39) D362E probably benign Het
Cep170 A G 1: 176,586,068 (GRCm39) S575P probably benign Het
Col4a2 C T 8: 11,493,413 (GRCm39) P1374L possibly damaging Het
Cpt2 T C 4: 107,761,556 (GRCm39) H617R probably benign Het
Cyp2d22 A G 15: 82,258,207 (GRCm39) S138P probably damaging Het
Cyp2j11 T C 4: 96,195,619 (GRCm39) D359G probably benign Het
Ddb2 T C 2: 91,042,337 (GRCm39) S419G possibly damaging Het
Dmrtc2 A T 7: 24,572,341 (GRCm39) I121F probably benign Het
Dus1l C T 11: 120,684,724 (GRCm39) R149H probably damaging Het
Fam90a1a T A 8: 22,453,640 (GRCm39) Y332N probably benign Het
Fbxo47 A T 11: 97,770,254 (GRCm39) V46D probably benign Het
Grep1 A G 17: 23,937,387 (GRCm39) S54P unknown Het
Grpel1 T A 5: 36,628,007 (GRCm39) V96E possibly damaging Het
Ifi207 A T 1: 173,555,143 (GRCm39) N853K probably damaging Het
Igkv4-80 C T 6: 68,993,751 (GRCm39) A47T probably damaging Het
Il1a T A 2: 129,149,826 (GRCm39) I25F probably benign Het
Ireb2 T A 9: 54,811,523 (GRCm39) probably null Het
Itpr1 A G 6: 108,328,979 (GRCm39) Y131C probably damaging Het
Kmt2a T C 9: 44,731,261 (GRCm39) probably benign Het
Lancl1 T A 1: 67,077,794 (GRCm39) probably benign Het
Lpl G A 8: 69,340,196 (GRCm39) V64M possibly damaging Het
Marchf10 T C 11: 105,280,581 (GRCm39) H568R probably damaging Het
Mib1 G A 18: 10,775,685 (GRCm39) V546M probably damaging Het
Mss51 A T 14: 20,534,939 (GRCm39) I277N probably benign Het
Mybpc1 A G 10: 88,360,829 (GRCm39) probably null Het
Myct1 A C 10: 5,554,195 (GRCm39) I21L probably benign Het
Myo5c C A 9: 75,153,531 (GRCm39) A139E probably damaging Het
Nlrp4e C G 7: 23,020,755 (GRCm39) A414G probably benign Het
Npy2r A T 3: 82,447,728 (GRCm39) I349N possibly damaging Het
Nrap T C 19: 56,378,255 (GRCm39) I19V probably benign Het
Or10g7 T C 9: 39,905,360 (GRCm39) S85P possibly damaging Het
Or14j2 A C 17: 37,886,135 (GRCm39) Y60D probably damaging Het
Or52n20 T C 7: 104,320,220 (GRCm39) F104L possibly damaging Het
Or5p6 C T 7: 107,631,230 (GRCm39) V107I probably benign Het
Or6c3b A T 10: 129,527,829 (GRCm39) V27D probably benign Het
Or8d23 T C 9: 38,841,818 (GRCm39) V117A probably benign Het
Pde6b A T 5: 108,551,298 (GRCm39) N194I probably damaging Het
Polg TCTGGATGA TCTGGATGACTGGATGA 7: 79,114,779 (GRCm39) probably null Het
Polg GA GACTGGAGCA 7: 79,114,786 (GRCm39) probably null Het
Ptpn9 T C 9: 56,934,701 (GRCm39) M155T possibly damaging Het
Sdf2l1 T C 16: 16,949,498 (GRCm39) H116R probably damaging Het
Shld2 A G 14: 33,981,596 (GRCm39) V514A probably damaging Het
Slc37a1 T C 17: 31,552,643 (GRCm39) I316T probably damaging Het
Slc4a11 A C 2: 130,528,830 (GRCm39) L473R possibly damaging Het
Smg7 A G 1: 152,731,753 (GRCm39) M344T probably benign Het
Smg9 T C 7: 24,114,465 (GRCm39) L268P probably damaging Het
Tiparp C T 3: 65,439,272 (GRCm39) T196I probably benign Het
Trappc12 A G 12: 28,742,491 (GRCm39) probably null Het
Trappc9 A T 15: 72,565,431 (GRCm39) N953K probably benign Het
Trpa1 A G 1: 14,968,564 (GRCm39) V428A probably benign Het
Utp20 T C 10: 88,583,170 (GRCm39) R2728G probably damaging Het
Zfp612 A G 8: 110,815,372 (GRCm39) E193G probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGGACAAAGGAATAGCCCCTTG -3'
(R):5'- ACACTGAACCCTGGAATTCCTG -3'

Sequencing Primer
(F):5'- AATAGCCCCTTGAGGCTGGAAC -3'
(R):5'- CTGGAATTCCTGCCCCTC -3'
Posted On 2022-04-18