Incidental Mutation 'R9323:Ptpn9'
ID 706330
Institutional Source Beutler Lab
Gene Symbol Ptpn9
Ensembl Gene ENSMUSG00000032290
Gene Name protein tyrosine phosphatase, non-receptor type 9
Synonyms Meg2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock # R9323 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 56994923-57062807 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57027417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 155 (M155T)
Ref Sequence ENSEMBL: ENSMUSP00000034832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034832] [ENSMUST00000216034]
AlphaFold O35239
Predicted Effect possibly damaging
Transcript: ENSMUST00000034832
AA Change: M155T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034832
Gene: ENSMUSG00000032290
AA Change: M155T

DomainStartEndE-ValueType
CRAL_TRIO_N 43 68 1.14e0 SMART
SEC14 90 240 7.33e-40 SMART
PTPc 302 576 1.01e-136 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000216034
AA Change: M78T

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain that shares a significant similarity with yeast SEC14, which is a protein that has phosphatidylinositol transfer activity and is required for protein secretion through the Golgi complex in yeast. This PTP was found to be activated by polyphosphoinositide, and is thought to be involved in signaling events regulating phagocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display hemorrhages, craniofacial anomalies, neural tube defects such as exencephaly and meningomyeloceles, cerebral infarctions, abnormal bone development, and >90% late embryonic lethality in addition to severe defectsin T lymphocyte and platelet activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,718,413 S54P unknown Het
5430419D17Rik T A 7: 131,226,672 N285K probably damaging Het
Abat G A 16: 8,602,371 W178* probably null Het
Alx1 G A 10: 103,022,263 R192* probably null Het
Apom A G 17: 35,131,657 C23R probably damaging Het
Asap2 A G 12: 21,112,147 N35S probably benign Het
Atf6 A T 1: 170,855,113 Y43* probably null Het
Bag4 T C 8: 25,771,333 S127G possibly damaging Het
Bag4 G T 8: 25,785,152 S7* probably null Het
Ccdc88b A G 19: 6,849,107 L1080P probably damaging Het
Cdkl2 A T 5: 92,020,248 D362E probably benign Het
Cep170 A G 1: 176,758,502 S575P probably benign Het
Col4a2 C T 8: 11,443,413 P1374L possibly damaging Het
Cpt2 T C 4: 107,904,359 H617R probably benign Het
Cyp2d22 A G 15: 82,374,006 S138P probably damaging Het
Cyp2j11 T C 4: 96,307,382 D359G probably benign Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Dmrtc2 A T 7: 24,872,916 I121F probably benign Het
Dus1l C T 11: 120,793,898 R149H probably damaging Het
Fam214a C T 9: 74,976,133 probably benign Het
Fam35a A G 14: 34,259,639 V514A probably damaging Het
Fam90a1a T A 8: 21,963,624 Y332N probably benign Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Grpel1 T A 5: 36,470,663 V96E possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Igkv4-80 C T 6: 69,016,767 A47T probably damaging Het
Il1a T A 2: 129,307,906 I25F probably benign Het
Ireb2 T A 9: 54,904,239 probably null Het
Itpr1 A G 6: 108,352,018 Y131C probably damaging Het
Kmt2a T C 9: 44,819,964 probably benign Het
Lancl1 T A 1: 67,038,635 probably benign Het
Lpl G A 8: 68,887,544 V64M possibly damaging Het
March10 T C 11: 105,389,755 H568R probably damaging Het
Mib1 G A 18: 10,775,685 V546M probably damaging Het
Mss51 A T 14: 20,484,871 I277N probably benign Het
Mybpc1 A G 10: 88,524,967 probably null Het
Myct1 A C 10: 5,604,195 I21L probably benign Het
Myo5c C A 9: 75,246,249 A139E probably damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Npy2r A T 3: 82,540,421 I349N possibly damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Olfr113 A C 17: 37,575,244 Y60D probably damaging Het
Olfr478 C T 7: 108,032,023 V107I probably benign Het
Olfr659 T C 7: 104,671,013 F104L possibly damaging Het
Olfr803 A T 10: 129,691,960 V27D probably benign Het
Olfr930 T C 9: 38,930,522 V117A probably benign Het
Olfr978 T C 9: 39,994,064 S85P possibly damaging Het
Pde6b A T 5: 108,403,432 N194I probably damaging Het
Polg TCTGGATGA TCTGGATGACTGGATGA 7: 79,465,031 probably null Het
Polg GA GACTGGAGCA 7: 79,465,038 probably null Het
Ret A G 6: 118,182,014 Y146H probably benign Het
Sdf2l1 T C 16: 17,131,634 H116R probably damaging Het
Slc37a1 T C 17: 31,333,669 I316T probably damaging Het
Slc4a11 A C 2: 130,686,910 L473R possibly damaging Het
Smg7 A G 1: 152,856,002 M344T probably benign Het
Smg9 T C 7: 24,415,040 L268P probably damaging Het
Tiparp C T 3: 65,531,851 T196I probably benign Het
Trappc12 A G 12: 28,692,492 probably null Het
Trappc9 A T 15: 72,693,582 N953K probably benign Het
Trpa1 A G 1: 14,898,340 V428A probably benign Het
Utp20 T C 10: 88,747,308 R2728G probably damaging Het
Zfp612 A G 8: 110,088,740 E193G probably benign Het
Other mutations in Ptpn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Ptpn9 APN 9 57036703 missense possibly damaging 0.68
IGL01388:Ptpn9 APN 9 57036718 missense probably benign 0.00
IGL01953:Ptpn9 APN 9 57056788 missense possibly damaging 0.69
IGL02525:Ptpn9 APN 9 57036725 nonsense probably null
IGL03294:Ptpn9 APN 9 57027387 missense possibly damaging 0.79
BB009:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
BB019:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
PIT4486001:Ptpn9 UTSW 9 57061003 missense probably damaging 0.99
R0530:Ptpn9 UTSW 9 57061133 missense probably benign
R1617:Ptpn9 UTSW 9 57027408 missense possibly damaging 0.79
R1964:Ptpn9 UTSW 9 57059912 missense probably damaging 1.00
R2426:Ptpn9 UTSW 9 57027428 missense possibly damaging 0.61
R4394:Ptpn9 UTSW 9 57036563 missense possibly damaging 0.91
R4606:Ptpn9 UTSW 9 57022211 missense possibly damaging 0.71
R4658:Ptpn9 UTSW 9 57020037 missense probably benign 0.01
R4660:Ptpn9 UTSW 9 57036498 missense probably benign 0.17
R5141:Ptpn9 UTSW 9 57036676 missense possibly damaging 0.56
R5150:Ptpn9 UTSW 9 57036670 missense probably benign
R5289:Ptpn9 UTSW 9 57060063 critical splice donor site probably null
R5389:Ptpn9 UTSW 9 57056837 intron probably benign
R5422:Ptpn9 UTSW 9 57033157 missense probably damaging 1.00
R5437:Ptpn9 UTSW 9 57020037 missense possibly damaging 0.80
R6075:Ptpn9 UTSW 9 57061146 missense probably benign 0.00
R6084:Ptpn9 UTSW 9 57033163 nonsense probably null
R6481:Ptpn9 UTSW 9 57023040 missense probably damaging 1.00
R7120:Ptpn9 UTSW 9 57059882 missense probably damaging 1.00
R7194:Ptpn9 UTSW 9 57022286 missense probably damaging 1.00
R7195:Ptpn9 UTSW 9 57022249 missense probably benign 0.02
R7349:Ptpn9 UTSW 9 57044376 missense probably benign 0.16
R7439:Ptpn9 UTSW 9 57027433 nonsense probably null
R7441:Ptpn9 UTSW 9 57027433 nonsense probably null
R7801:Ptpn9 UTSW 9 57061013 missense probably benign 0.36
R7879:Ptpn9 UTSW 9 57056726 missense possibly damaging 0.50
R7932:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
R9433:Ptpn9 UTSW 9 57056726 missense possibly damaging 0.50
R9614:Ptpn9 UTSW 9 57036721 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTTCCTGTCTAGAAATAGTGCAAAC -3'
(R):5'- GCCATCTCAAATCTTTCAACTTGAC -3'

Sequencing Primer
(F):5'- ACTTCATATCTGACAGGTGAGATGGC -3'
(R):5'- GGTGACCTTTAAAATTGAACATA -3'
Posted On 2022-04-18