Incidental Mutation 'R0739:Klf11'
ID70634
Institutional Source Beutler Lab
Gene Symbol Klf11
Ensembl Gene ENSMUSG00000020653
Gene NameKruppel-like factor 11
SynonymsTieg2b, D12Ertd427e, Tieg3, Tieg2
MMRRC Submission 038920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0739 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location24651274-24662789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24660248 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 432 (S432P)
Ref Sequence ENSEMBL: ENSMUSP00000020982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020982]
Predicted Effect probably damaging
Transcript: ENSMUST00000020982
AA Change: S432P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020982
Gene: ENSMUSG00000020653
AA Change: S432P

DomainStartEndE-ValueType
low complexity region 267 275 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
ZnF_C2H2 384 408 5.9e-3 SMART
ZnF_C2H2 414 438 9.22e-5 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
Meta Mutation Damage Score 0.5685 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to SP1-like sequences in epsilon- and gamma-globin gene promoters. This binding inhibits cell growth and causes apoptosis. Defects in this gene are a cause of maturity-onset diabetes of the young type 7 (MODY7). Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, show normal hematopoiesis, growth and development, and display no evidence of increased tumor formation following gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Axdnd1 T C 1: 156,380,886 N396D possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Ccr8 G A 9: 120,094,349 G177S probably damaging Het
Clmn C T 12: 104,781,017 G757D possibly damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Elovl4 A G 9: 83,785,109 F65S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Neo1 C T 9: 58,921,877 A580T probably benign Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr486 T C 7: 108,172,010 T245A probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Klf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Klf11 APN 12 24660369 missense probably benign 0.01
IGL02202:Klf11 APN 12 24653632 missense probably benign 0.37
IGL02527:Klf11 APN 12 24655323 missense probably benign 0.31
IGL02964:Klf11 APN 12 24655627 missense probably damaging 1.00
R0254:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R0553:Klf11 UTSW 12 24655090 missense probably benign 0.12
R1584:Klf11 UTSW 12 24655305 missense probably damaging 1.00
R1592:Klf11 UTSW 12 24653738 missense probably damaging 1.00
R2356:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R3085:Klf11 UTSW 12 24655491 missense probably benign
R4690:Klf11 UTSW 12 24655072 missense probably damaging 0.97
R5023:Klf11 UTSW 12 24655359 missense probably benign 0.00
R5483:Klf11 UTSW 12 24655411 nonsense probably null
R5528:Klf11 UTSW 12 24654930 missense probably benign 0.00
R6148:Klf11 UTSW 12 24651568 critical splice donor site probably null
R6698:Klf11 UTSW 12 24653619 missense probably damaging 1.00
R6799:Klf11 UTSW 12 24655639 missense possibly damaging 0.59
R7317:Klf11 UTSW 12 24655519 missense possibly damaging 0.59
R7384:Klf11 UTSW 12 24653743 missense probably damaging 0.97
R7440:Klf11 UTSW 12 24655491 missense probably benign
R7473:Klf11 UTSW 12 24655142 splice site probably null
R7477:Klf11 UTSW 12 24653563 missense probably benign 0.01
R7658:Klf11 UTSW 12 24653671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTGTACTAAGCAAGACCCTAC -3'
(R):5'- AGTGATTCTGTTCAGCTTGCCCAC -3'

Sequencing Primer
(F):5'- gtcagggctacacagtgag -3'
(R):5'- AGCTTGCCCACCTCTGC -3'
Posted On2013-09-30