Incidental Mutation 'R0739:Clmn'
ID70637
Institutional Source Beutler Lab
Gene Symbol Clmn
Ensembl Gene ENSMUSG00000021097
Gene Namecalmin
Synonyms
MMRRC Submission 038920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0739 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104763117-104865076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104781017 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 757 (G757D)
Ref Sequence ENSEMBL: ENSMUSP00000152070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109936] [ENSMUST00000109937] [ENSMUST00000222323] [ENSMUST00000223103] [ENSMUST00000223177] [ENSMUST00000223342]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109936
AA Change: G757D

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105562
Gene: ENSMUSG00000021097
AA Change: G757D

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 996 1013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109937
AA Change: G757D

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105563
Gene: ENSMUSG00000021097
AA Change: G757D

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 1027 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222412
Predicted Effect possibly damaging
Transcript: ENSMUST00000223103
AA Change: G757D

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223177
AA Change: G757D

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223342
AA Change: G757D

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Axdnd1 T C 1: 156,380,886 N396D possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Ccr8 G A 9: 120,094,349 G177S probably damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Elovl4 A G 9: 83,785,109 F65S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Klf11 T C 12: 24,660,248 S432P probably damaging Het
Neo1 C T 9: 58,921,877 A580T probably benign Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr486 T C 7: 108,172,010 T245A probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Clmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Clmn APN 12 104774551 critical splice acceptor site probably null
IGL01509:Clmn APN 12 104780903 missense probably benign 0.00
IGL01530:Clmn APN 12 104791856 missense probably damaging 1.00
IGL01768:Clmn APN 12 104781719 missense probably damaging 0.99
IGL01779:Clmn APN 12 104782140 missense probably benign 0.04
IGL02139:Clmn APN 12 104781099 missense probably benign 0.01
IGL02157:Clmn APN 12 104781918 missense probably benign 0.00
IGL02519:Clmn APN 12 104791853 missense probably damaging 1.00
IGL02820:Clmn APN 12 104773234 missense probably damaging 0.99
IGL03036:Clmn APN 12 104774523 missense probably damaging 0.97
R0255:Clmn UTSW 12 104781764 missense probably benign
R0478:Clmn UTSW 12 104785491 missense probably damaging 0.99
R0761:Clmn UTSW 12 104781558 missense probably damaging 0.99
R0834:Clmn UTSW 12 104771826 missense probably damaging 1.00
R0834:Clmn UTSW 12 104771827 missense probably damaging 1.00
R0864:Clmn UTSW 12 104790015 missense possibly damaging 0.94
R1569:Clmn UTSW 12 104781081 missense probably damaging 1.00
R1638:Clmn UTSW 12 104782022 missense probably benign 0.13
R1940:Clmn UTSW 12 104790102 missense probably damaging 1.00
R1974:Clmn UTSW 12 104791862 missense probably damaging 1.00
R2113:Clmn UTSW 12 104780808 missense probably benign
R4815:Clmn UTSW 12 104785566 missense probably damaging 1.00
R4863:Clmn UTSW 12 104797094 missense probably damaging 1.00
R4883:Clmn UTSW 12 104782048 missense probably benign 0.04
R5577:Clmn UTSW 12 104777070 missense probably damaging 1.00
R5853:Clmn UTSW 12 104783902 splice site probably null
R5867:Clmn UTSW 12 104781755 missense probably damaging 0.98
R6041:Clmn UTSW 12 104781872 missense probably benign 0.00
R6093:Clmn UTSW 12 104771956 missense probably benign 0.00
R6233:Clmn UTSW 12 104785455 missense probably damaging 1.00
R6239:Clmn UTSW 12 104780845 missense probably benign 0.00
R6628:Clmn UTSW 12 104773786 missense probably damaging 1.00
R6771:Clmn UTSW 12 104773782 missense probably benign 0.04
R7448:Clmn UTSW 12 104785428 missense possibly damaging 0.90
R7633:Clmn UTSW 12 104782112 missense probably benign
X0028:Clmn UTSW 12 104785402 missense probably benign 0.11
Z1177:Clmn UTSW 12 104781376 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCGACATGGGACACATGCTCAC -3'
(R):5'- CTCGTCATCACAGCGAGGAAGAAG -3'

Sequencing Primer
(F):5'- ACATGCTCACTGACGCTG -3'
(R):5'- GTCTGTGAAGAAGAAATACCATCC -3'
Posted On2013-09-30