Incidental Mutation 'R9324:Fam234b'
ID 706377
Institutional Source Beutler Lab
Gene Symbol Fam234b
Ensembl Gene ENSMUSG00000030207
Gene Name family with sequence similarity 234, member B
Synonyms 8430419L09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 135197977-135244955 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 135225795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 382 (Y382*)
Ref Sequence ENSEMBL: ENSMUSP00000107547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111915] [ENSMUST00000111916]
AlphaFold Q8BYI8
Predicted Effect probably null
Transcript: ENSMUST00000111915
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207
AA Change: Y382*

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111916
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207
AA Change: Y382*

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,580,633 H358R probably benign Het
Arid3c A G 4: 41,730,138 L19S possibly damaging Het
Arpp21 T A 9: 112,157,697 D262V probably damaging Het
Atp4a A C 7: 30,715,782 I276L probably benign Het
Axl C G 7: 25,761,557 E676Q probably damaging Het
Ccdc151 T C 9: 21,991,911 E402G probably damaging Het
Ces1g T C 8: 93,328,490 D193G probably damaging Het
Crym A G 7: 120,189,782 V274A probably damaging Het
Efcab5 T A 11: 77,113,720 H924L possibly damaging Het
Eif3l T A 15: 79,094,223 M560K probably benign Het
Fam160a1 T C 3: 85,730,746 D82G probably benign Het
Fam71b A T 11: 46,404,983 I61F Het
Fbxw19 T C 9: 109,484,372 K253E possibly damaging Het
Flt3 A G 5: 147,376,980 S87P probably benign Het
Ggnbp2 A G 11: 84,834,348 L627S probably damaging Het
Gm16486 C T 8: 70,709,145 T329I possibly damaging Het
Gm26661 T G 14: 7,791,765 V60G unknown Het
Gm5065 G A 7: 5,359,528 V53I possibly damaging Het
Gm5662 T A 12: 88,271,939 N17I unknown Het
Golt1a T C 1: 133,319,356 L34P probably damaging Het
Gp5 T C 16: 30,308,990 M289V possibly damaging Het
Gpr63 C G 4: 25,008,432 H385Q possibly damaging Het
Hcn1 G A 13: 117,975,365 V622I unknown Het
Hipk4 A G 7: 27,529,409 D428G probably damaging Het
Hs3st1 T C 5: 39,614,802 Y166C probably damaging Het
Hsd17b3 A G 13: 64,058,645 F281S possibly damaging Het
Ifih1 T C 2: 62,645,606 T109A probably benign Het
Ighv1-64 T A 12: 115,508,025 probably benign Het
Ina T C 19: 47,015,377 L208P Het
Irak2 T C 6: 113,638,643 probably null Het
Klhl10 G A 11: 100,447,655 E407K probably benign Het
Krt81 A G 15: 101,463,454 S82P probably damaging Het
Ktn1 C A 14: 47,710,896 Q963K probably benign Het
Lrrc42 A T 4: 107,247,716 Y17* probably null Het
Lrrc9 A C 12: 72,449,397 E15D probably damaging Het
Mak G A 13: 41,049,363 T203I probably benign Het
Masp2 T C 4: 148,608,028 V326A possibly damaging Het
Mdc1 T C 17: 35,853,366 S1269P probably benign Het
Mink1 G A 11: 70,611,651 V1027M probably damaging Het
Mrps10 C A 17: 47,375,978 S123* probably null Het
Myl10 C T 5: 136,700,933 H142Y probably damaging Het
Ncan T C 8: 70,107,998 Q773R possibly damaging Het
Nlrp3 T A 11: 59,543,315 M68K probably damaging Het
Ntrk1 C T 3: 87,791,438 V99M possibly damaging Het
Olfr1184 C T 2: 88,487,443 T237I probably damaging Het
Olfr143 A G 9: 38,253,666 K80R probably benign Het
Olfr1434 A G 19: 12,283,575 R176G probably benign Het
Phldb2 A G 16: 45,775,074 V830A probably damaging Het
Phospho2 T C 2: 69,795,569 V23A probably damaging Het
Plxnc1 G A 10: 94,944,823 probably benign Het
Ppcdc T C 9: 57,434,997 E14G probably benign Het
Ralgapa2 T C 2: 146,460,725 Y106C probably damaging Het
Rgs22 T C 15: 36,087,398 Q582R probably benign Het
Rngtt T A 4: 33,320,613 Y53* probably null Het
Slc12a3 T G 8: 94,356,400 probably null Het
Slc26a11 A G 11: 119,376,904 T456A probably benign Het
Slc26a5 G T 5: 21,813,336 A677E possibly damaging Het
Smurf1 T C 5: 144,880,653 T690A probably benign Het
Spata24 A T 18: 35,657,011 N142K probably damaging Het
Ubqlnl A T 7: 104,149,755 N178K possibly damaging Het
Uggt2 A G 14: 119,075,329 probably null Het
Vmn1r2 C A 4: 3,172,678 A199D probably damaging Het
Vmn2r39 T C 7: 9,027,685 N128S probably damaging Het
Vmn2r61 G T 7: 42,267,195 V411F probably benign Het
Vmn2r-ps117 T A 17: 18,822,649 F106L probably benign Het
Zfp503 A T 14: 21,985,285 I521N possibly damaging Het
Zfp831 T C 2: 174,705,320 V1432A probably benign Het
Zfp981 T A 4: 146,535,427 L13I possibly damaging Het
Other mutations in Fam234b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Fam234b APN 6 135225204 missense probably damaging 1.00
IGL01020:Fam234b APN 6 135211906 missense probably benign 0.13
IGL01731:Fam234b APN 6 135211905 missense possibly damaging 0.90
IGL01994:Fam234b APN 6 135225205 nonsense probably null
IGL02010:Fam234b APN 6 135209407 missense probably benign 0.17
IGL02071:Fam234b APN 6 135227151 critical splice acceptor site probably null
IGL02340:Fam234b APN 6 135231661 missense probably damaging 1.00
IGL02869:Fam234b APN 6 135225203 missense probably damaging 1.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0123:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0127:Fam234b UTSW 6 135218823 splice site probably benign
R0225:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0570:Fam234b UTSW 6 135209249 missense probably benign 0.00
R0705:Fam234b UTSW 6 135227215 missense probably benign 0.11
R1140:Fam234b UTSW 6 135225758 missense probably benign 0.00
R1446:Fam234b UTSW 6 135209330 splice site probably null
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R2044:Fam234b UTSW 6 135226914 missense probably benign 0.04
R2350:Fam234b UTSW 6 135231724 missense probably damaging 1.00
R3914:Fam234b UTSW 6 135225683 missense probably damaging 1.00
R4261:Fam234b UTSW 6 135209136 missense unknown
R5102:Fam234b UTSW 6 135209284 missense probably benign 0.03
R5133:Fam234b UTSW 6 135209195 missense probably benign 0.01
R5313:Fam234b UTSW 6 135209187 missense possibly damaging 0.56
R5375:Fam234b UTSW 6 135233357 missense probably damaging 1.00
R5418:Fam234b UTSW 6 135226968 missense probably benign 0.00
R5838:Fam234b UTSW 6 135225267 missense probably benign 0.00
R5953:Fam234b UTSW 6 135225707 missense possibly damaging 0.95
R6737:Fam234b UTSW 6 135228515 missense probably damaging 0.99
R7056:Fam234b UTSW 6 135228452 missense probably benign 0.32
R7221:Fam234b UTSW 6 135228531 missense probably damaging 1.00
R7418:Fam234b UTSW 6 135217011 missense probably benign 0.04
R7459:Fam234b UTSW 6 135211901 missense probably benign 0.04
R7599:Fam234b UTSW 6 135226876 missense probably damaging 1.00
R7602:Fam234b UTSW 6 135225243 missense possibly damaging 0.79
R7639:Fam234b UTSW 6 135225800 splice site probably null
R7748:Fam234b UTSW 6 135209351 missense probably damaging 1.00
R7773:Fam234b UTSW 6 135243914 missense probably benign 0.01
R8544:Fam234b UTSW 6 135233289 missense probably damaging 1.00
R9733:Fam234b UTSW 6 135217010 missense possibly damaging 0.50
Z1177:Fam234b UTSW 6 135198008 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTGCTCAATTTGACTC -3'
(R):5'- GGGAGAGAAGTCAAAGCTTTCC -3'

Sequencing Primer
(F):5'- CTTCCTGTGGCACTAGGAAAC -3'
(R):5'- AGAGAAGTCAAAGCTTTCCTATCTAG -3'
Posted On 2022-04-18