Mutagenetix > Incidental Mutation

Incidental Mutation 'R9324:Ncan'

706387

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70107998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 773 (Q773R)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002412
AA Change: Q773R

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: Q773R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	A	G	7: 119,580,633	H358R	probably benign	Het
Arid3c	A	G	4: 41,730,138	L19S	possibly damaging	Het
Arpp21	T	A	9: 112,157,697	D262V	probably damaging	Het
Atp4a	A	C	7: 30,715,782	I276L	probably benign	Het
Axl	C	G	7: 25,761,557	E676Q	probably damaging	Het
Ccdc151	T	C	9: 21,991,911	E402G	probably damaging	Het
Ces1g	T	C	8: 93,328,490	D193G	probably damaging	Het
Crym	A	G	7: 120,189,782	V274A	probably damaging	Het
Efcab5	T	A	11: 77,113,720	H924L	possibly damaging	Het
Eif3l	T	A	15: 79,094,223	M560K	probably benign	Het
Fam160a1	T	C	3: 85,730,746	D82G	probably benign	Het
Fam234b	C	A	6: 135,225,795	Y382*	probably null	Het
Fam71b	A	T	11: 46,404,983	I61F		Het
Fbxw19	T	C	9: 109,484,372	K253E	possibly damaging	Het
Flt3	A	G	5: 147,376,980	S87P	probably benign	Het
Ggnbp2	A	G	11: 84,834,348	L627S	probably damaging	Het
Gm16486	C	T	8: 70,709,145	T329I	possibly damaging	Het
Gm26661	T	G	14: 7,791,765	V60G	unknown	Het
Gm5065	G	A	7: 5,359,528	V53I	possibly damaging	Het
Gm5662	T	A	12: 88,271,939	N17I	unknown	Het
Golt1a	T	C	1: 133,319,356	L34P	probably damaging	Het
Gp5	T	C	16: 30,308,990	M289V	possibly damaging	Het
Gpr63	C	G	4: 25,008,432	H385Q	possibly damaging	Het
Hcn1	G	A	13: 117,975,365	V622I	unknown	Het
Hipk4	A	G	7: 27,529,409	D428G	probably damaging	Het
Hs3st1	T	C	5: 39,614,802	Y166C	probably damaging	Het
Hsd17b3	A	G	13: 64,058,645	F281S	possibly damaging	Het
Ifih1	T	C	2: 62,645,606	T109A	probably benign	Het
Ighv1-64	T	A	12: 115,508,025		probably benign	Het
Ina	T	C	19: 47,015,377	L208P		Het
Irak2	T	C	6: 113,638,643		probably null	Het
Klhl10	G	A	11: 100,447,655	E407K	probably benign	Het
Krt81	A	G	15: 101,463,454	S82P	probably damaging	Het
Ktn1	C	A	14: 47,710,896	Q963K	probably benign	Het
Lrrc42	A	T	4: 107,247,716	Y17*	probably null	Het
Lrrc9	A	C	12: 72,449,397	E15D	probably damaging	Het
Mak	G	A	13: 41,049,363	T203I	probably benign	Het
Masp2	T	C	4: 148,608,028	V326A	possibly damaging	Het
Mdc1	T	C	17: 35,853,366	S1269P	probably benign	Het
Mink1	G	A	11: 70,611,651	V1027M	probably damaging	Het
Mrps10	C	A	17: 47,375,978	S123*	probably null	Het
Myl10	C	T	5: 136,700,933	H142Y	probably damaging	Het
Nlrp3	T	A	11: 59,543,315	M68K	probably damaging	Het
Ntrk1	C	T	3: 87,791,438	V99M	possibly damaging	Het
Olfr1184	C	T	2: 88,487,443	T237I	probably damaging	Het
Olfr143	A	G	9: 38,253,666	K80R	probably benign	Het
Olfr1434	A	G	19: 12,283,575	R176G	probably benign	Het
Phldb2	A	G	16: 45,775,074	V830A	probably damaging	Het
Phospho2	T	C	2: 69,795,569	V23A	probably damaging	Het
Plxnc1	G	A	10: 94,944,823		probably benign	Het
Ppcdc	T	C	9: 57,434,997	E14G	probably benign	Het
Ralgapa2	T	C	2: 146,460,725	Y106C	probably damaging	Het
Rgs22	T	C	15: 36,087,398	Q582R	probably benign	Het
Rngtt	T	A	4: 33,320,613	Y53*	probably null	Het
Slc12a3	T	G	8: 94,356,400		probably null	Het
Slc26a11	A	G	11: 119,376,904	T456A	probably benign	Het
Slc26a5	G	T	5: 21,813,336	A677E	possibly damaging	Het
Smurf1	T	C	5: 144,880,653	T690A	probably benign	Het
Spata24	A	T	18: 35,657,011	N142K	probably damaging	Het
Ubqlnl	A	T	7: 104,149,755	N178K	possibly damaging	Het
Uggt2	A	G	14: 119,075,329		probably null	Het
Vmn1r2	C	A	4: 3,172,678	A199D	probably damaging	Het
Vmn2r39	T	C	7: 9,027,685	N128S	probably damaging	Het
Vmn2r61	G	T	7: 42,267,195	V411F	probably benign	Het
Vmn2r-ps117	T	A	17: 18,822,649	F106L	probably benign	Het
Zfp503	A	T	14: 21,985,285	I521N	possibly damaging	Het
Zfp831	T	C	2: 174,705,320	V1432A	probably benign	Het
Zfp981	T	A	4: 146,535,427	L13I	possibly damaging	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GATTCAGACTCCCAAGTGGCATC -3'
(R):5'- ACAGATCCCCTGATGCAGATTC -3'

Sequencing Primer
(F):5'- TCCCAAGTGGCATCAGCAGTG -3'
(R):5'- CAGATCCCCTGATGCAGATTCTATAG -3'

Posted On

2022-04-18