Incidental Mutation 'R9324:Ncan'
ID 706387
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70560648 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 773 (Q773R)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000002412
AA Change: Q773R

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: Q773R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,179,856 (GRCm39) H358R probably benign Het
Arid3c A G 4: 41,730,138 (GRCm39) L19S possibly damaging Het
Arpp21 T A 9: 111,986,765 (GRCm39) D262V probably damaging Het
Atp4a A C 7: 30,415,207 (GRCm39) I276L probably benign Het
Axl C G 7: 25,460,982 (GRCm39) E676Q probably damaging Het
Ces1g T C 8: 94,055,118 (GRCm39) D193G probably damaging Het
Crym A G 7: 119,789,005 (GRCm39) V274A probably damaging Het
Efcab5 T A 11: 77,004,546 (GRCm39) H924L possibly damaging Het
Eif1ad7 T A 12: 88,238,709 (GRCm39) N17I unknown Het
Eif3l T A 15: 78,978,423 (GRCm39) M560K probably benign Het
Fam234b C A 6: 135,202,793 (GRCm39) Y382* probably null Het
Fbxw19 T C 9: 109,313,440 (GRCm39) K253E possibly damaging Het
Fhip1a T C 3: 85,638,053 (GRCm39) D82G probably benign Het
Flt3 A G 5: 147,313,790 (GRCm39) S87P probably benign Het
Garin3 A T 11: 46,295,810 (GRCm39) I61F Het
Ggnbp2 A G 11: 84,725,174 (GRCm39) L627S probably damaging Het
Gm26661 T G 14: 7,791,765 (GRCm38) V60G unknown Het
Golt1a T C 1: 133,247,094 (GRCm39) L34P probably damaging Het
Gp5 T C 16: 30,127,808 (GRCm39) M289V possibly damaging Het
Gpr63 C G 4: 25,008,432 (GRCm39) H385Q possibly damaging Het
Hcn1 G A 13: 118,111,901 (GRCm39) V622I unknown Het
Hipk4 A G 7: 27,228,834 (GRCm39) D428G probably damaging Het
Hs3st1 T C 5: 39,772,145 (GRCm39) Y166C probably damaging Het
Hsd17b3 A G 13: 64,206,459 (GRCm39) F281S possibly damaging Het
Ifih1 T C 2: 62,475,950 (GRCm39) T109A probably benign Het
Ighv1-64 T A 12: 115,471,645 (GRCm39) probably benign Het
Ina T C 19: 47,003,816 (GRCm39) L208P Het
Iqcn C T 8: 71,161,794 (GRCm39) T329I possibly damaging Het
Irak2 T C 6: 113,615,604 (GRCm39) probably null Het
Klhl10 G A 11: 100,338,481 (GRCm39) E407K probably benign Het
Krt81 A G 15: 101,361,335 (GRCm39) S82P probably damaging Het
Ktn1 C A 14: 47,948,353 (GRCm39) Q963K probably benign Het
Lgalsl2 G A 7: 5,362,527 (GRCm39) V53I possibly damaging Het
Lrrc42 A T 4: 107,104,913 (GRCm39) Y17* probably null Het
Lrrc9 A C 12: 72,496,171 (GRCm39) E15D probably damaging Het
Mak G A 13: 41,202,839 (GRCm39) T203I probably benign Het
Masp2 T C 4: 148,692,485 (GRCm39) V326A possibly damaging Het
Mdc1 T C 17: 36,164,258 (GRCm39) S1269P probably benign Het
Mink1 G A 11: 70,502,477 (GRCm39) V1027M probably damaging Het
Mrps10 C A 17: 47,686,903 (GRCm39) S123* probably null Het
Myl10 C T 5: 136,729,787 (GRCm39) H142Y probably damaging Het
Nlrp3 T A 11: 59,434,141 (GRCm39) M68K probably damaging Het
Ntrk1 C T 3: 87,698,745 (GRCm39) V99M possibly damaging Het
Odad3 T C 9: 21,903,207 (GRCm39) E402G probably damaging Het
Or4p22 C T 2: 88,317,787 (GRCm39) T237I probably damaging Het
Or5an1 A G 19: 12,260,939 (GRCm39) R176G probably benign Het
Or8c8 A G 9: 38,164,962 (GRCm39) K80R probably benign Het
Phldb2 A G 16: 45,595,437 (GRCm39) V830A probably damaging Het
Phospho2 T C 2: 69,625,913 (GRCm39) V23A probably damaging Het
Plxnc1 G A 10: 94,780,685 (GRCm39) probably benign Het
Ppcdc T C 9: 57,342,280 (GRCm39) E14G probably benign Het
Ralgapa2 T C 2: 146,302,645 (GRCm39) Y106C probably damaging Het
Rgs22 T C 15: 36,087,544 (GRCm39) Q582R probably benign Het
Rngtt T A 4: 33,320,613 (GRCm39) Y53* probably null Het
Slc12a3 T G 8: 95,083,028 (GRCm39) probably null Het
Slc26a11 A G 11: 119,267,730 (GRCm39) T456A probably benign Het
Slc26a5 G T 5: 22,018,334 (GRCm39) A677E possibly damaging Het
Smurf1 T C 5: 144,817,463 (GRCm39) T690A probably benign Het
Spata24 A T 18: 35,790,064 (GRCm39) N142K probably damaging Het
Ubqlnl A T 7: 103,798,962 (GRCm39) N178K possibly damaging Het
Uggt2 A G 14: 119,312,741 (GRCm39) probably null Het
Vmn1r2 C A 4: 3,172,678 (GRCm39) A199D probably damaging Het
Vmn2r39 T C 7: 9,030,684 (GRCm39) N128S probably damaging Het
Vmn2r61 G T 7: 41,916,619 (GRCm39) V411F probably benign Het
Vmn2r-ps117 T A 17: 19,042,911 (GRCm39) F106L probably benign Het
Zfp503 A T 14: 22,035,353 (GRCm39) I521N possibly damaging Het
Zfp831 T C 2: 174,547,113 (GRCm39) V1432A probably benign Het
Zfp981 T A 4: 146,619,884 (GRCm39) L13I possibly damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATTCAGACTCCCAAGTGGCATC -3'
(R):5'- ACAGATCCCCTGATGCAGATTC -3'

Sequencing Primer
(F):5'- TCCCAAGTGGCATCAGCAGTG -3'
(R):5'- CAGATCCCCTGATGCAGATTCTATAG -3'
Posted On 2022-04-18