Incidental Mutation 'R9324:Ppcdc'
ID 706393
Institutional Source Beutler Lab
Gene Symbol Ppcdc
Ensembl Gene ENSMUSG00000063849
Gene Name phosphopantothenoylcysteine decarboxylase
Synonyms 1810057I13Rik, 8430432M10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R9324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 57385095-57440124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57434997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 14 (E14G)
Ref Sequence ENSEMBL: ENSMUSP00000082856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085709] [ENSMUST00000213194] [ENSMUST00000214065] [ENSMUST00000214144] [ENSMUST00000214166] [ENSMUST00000214339] [ENSMUST00000214624] [ENSMUST00000215299] [ENSMUST00000215883] [ENSMUST00000216365]
AlphaFold Q8BZB2
Predicted Effect probably benign
Transcript: ENSMUST00000085709
AA Change: E14G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082856
Gene: ENSMUSG00000063849
AA Change: E14G

DomainStartEndE-ValueType
Pfam:Flavoprotein 18 149 7.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213194
AA Change: E14G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214065
AA Change: E14G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214144
AA Change: E14G

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214166
AA Change: E14G

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214339
AA Change: E14G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000214624
AA Change: E14G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215299
AA Change: E14G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000215883
AA Change: E14G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000216365
AA Change: E14G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,580,633 H358R probably benign Het
Arid3c A G 4: 41,730,138 L19S possibly damaging Het
Arpp21 T A 9: 112,157,697 D262V probably damaging Het
Atp4a A C 7: 30,715,782 I276L probably benign Het
Axl C G 7: 25,761,557 E676Q probably damaging Het
Ccdc151 T C 9: 21,991,911 E402G probably damaging Het
Ces1g T C 8: 93,328,490 D193G probably damaging Het
Crym A G 7: 120,189,782 V274A probably damaging Het
Efcab5 T A 11: 77,113,720 H924L possibly damaging Het
Eif3l T A 15: 79,094,223 M560K probably benign Het
Fam160a1 T C 3: 85,730,746 D82G probably benign Het
Fam234b C A 6: 135,225,795 Y382* probably null Het
Fam71b A T 11: 46,404,983 I61F Het
Fbxw19 T C 9: 109,484,372 K253E possibly damaging Het
Flt3 A G 5: 147,376,980 S87P probably benign Het
Ggnbp2 A G 11: 84,834,348 L627S probably damaging Het
Gm16486 C T 8: 70,709,145 T329I possibly damaging Het
Gm26661 T G 14: 7,791,765 V60G unknown Het
Gm5065 G A 7: 5,359,528 V53I possibly damaging Het
Gm5662 T A 12: 88,271,939 N17I unknown Het
Golt1a T C 1: 133,319,356 L34P probably damaging Het
Gp5 T C 16: 30,308,990 M289V possibly damaging Het
Gpr63 C G 4: 25,008,432 H385Q possibly damaging Het
Hcn1 G A 13: 117,975,365 V622I unknown Het
Hipk4 A G 7: 27,529,409 D428G probably damaging Het
Hs3st1 T C 5: 39,614,802 Y166C probably damaging Het
Hsd17b3 A G 13: 64,058,645 F281S possibly damaging Het
Ifih1 T C 2: 62,645,606 T109A probably benign Het
Ighv1-64 T A 12: 115,508,025 probably benign Het
Ina T C 19: 47,015,377 L208P Het
Irak2 T C 6: 113,638,643 probably null Het
Klhl10 G A 11: 100,447,655 E407K probably benign Het
Krt81 A G 15: 101,463,454 S82P probably damaging Het
Ktn1 C A 14: 47,710,896 Q963K probably benign Het
Lrrc42 A T 4: 107,247,716 Y17* probably null Het
Lrrc9 A C 12: 72,449,397 E15D probably damaging Het
Mak G A 13: 41,049,363 T203I probably benign Het
Masp2 T C 4: 148,608,028 V326A possibly damaging Het
Mdc1 T C 17: 35,853,366 S1269P probably benign Het
Mink1 G A 11: 70,611,651 V1027M probably damaging Het
Mrps10 C A 17: 47,375,978 S123* probably null Het
Myl10 C T 5: 136,700,933 H142Y probably damaging Het
Ncan T C 8: 70,107,998 Q773R possibly damaging Het
Nlrp3 T A 11: 59,543,315 M68K probably damaging Het
Ntrk1 C T 3: 87,791,438 V99M possibly damaging Het
Olfr1184 C T 2: 88,487,443 T237I probably damaging Het
Olfr143 A G 9: 38,253,666 K80R probably benign Het
Olfr1434 A G 19: 12,283,575 R176G probably benign Het
Phldb2 A G 16: 45,775,074 V830A probably damaging Het
Phospho2 T C 2: 69,795,569 V23A probably damaging Het
Plxnc1 G A 10: 94,944,823 probably benign Het
Ralgapa2 T C 2: 146,460,725 Y106C probably damaging Het
Rgs22 T C 15: 36,087,398 Q582R probably benign Het
Rngtt T A 4: 33,320,613 Y53* probably null Het
Slc12a3 T G 8: 94,356,400 probably null Het
Slc26a11 A G 11: 119,376,904 T456A probably benign Het
Slc26a5 G T 5: 21,813,336 A677E possibly damaging Het
Smurf1 T C 5: 144,880,653 T690A probably benign Het
Spata24 A T 18: 35,657,011 N142K probably damaging Het
Ubqlnl A T 7: 104,149,755 N178K possibly damaging Het
Uggt2 A G 14: 119,075,329 probably null Het
Vmn1r2 C A 4: 3,172,678 A199D probably damaging Het
Vmn2r39 T C 7: 9,027,685 N128S probably damaging Het
Vmn2r61 G T 7: 42,267,195 V411F probably benign Het
Vmn2r-ps117 T A 17: 18,822,649 F106L probably benign Het
Zfp503 A T 14: 21,985,285 I521N possibly damaging Het
Zfp831 T C 2: 174,705,320 V1432A probably benign Het
Zfp981 T A 4: 146,535,427 L13I possibly damaging Het
Other mutations in Ppcdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ppcdc APN 9 57415140 missense probably benign 0.00
R0945:Ppcdc UTSW 9 57420158 splice site probably null
R1666:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R3684:Ppcdc UTSW 9 57421125 critical splice donor site probably null
R4223:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R4821:Ppcdc UTSW 9 57434911 missense probably benign 0.00
R5121:Ppcdc UTSW 9 57421163 missense possibly damaging 0.56
R5236:Ppcdc UTSW 9 57414654 missense probably benign 0.00
R7034:Ppcdc UTSW 9 57415170 missense probably damaging 1.00
R7303:Ppcdc UTSW 9 57414675 missense probably benign
R7591:Ppcdc UTSW 9 57434979 missense probably damaging 1.00
R7835:Ppcdc UTSW 9 57420276 missense probably benign 0.02
R8942:Ppcdc UTSW 9 57434982 missense probably benign 0.00
R8944:Ppcdc UTSW 9 57434982 missense probably benign 0.00
R9378:Ppcdc UTSW 9 57420288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGAAAATCCCATGCCCTG -3'
(R):5'- CTTGGTCATCATACCGCGTG -3'

Sequencing Primer
(F):5'- TGCAGACGCAGGACTCCTTAG -3'
(R):5'- AGCTGGGACTTTTAAAGCCC -3'
Posted On 2022-04-18