Incidental Mutation 'R9324:Efcab5'
ID 706400
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 77089915-77188968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77113720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 924 (H924L)
Ref Sequence ENSEMBL: ENSMUSP00000118152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably damaging
Transcript: ENSMUST00000108400
AA Change: H1060L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: H1060L

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130901
AA Change: H924L

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: H924L

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,580,633 H358R probably benign Het
Arid3c A G 4: 41,730,138 L19S possibly damaging Het
Arpp21 T A 9: 112,157,697 D262V probably damaging Het
Atp4a A C 7: 30,715,782 I276L probably benign Het
Axl C G 7: 25,761,557 E676Q probably damaging Het
Ccdc151 T C 9: 21,991,911 E402G probably damaging Het
Ces1g T C 8: 93,328,490 D193G probably damaging Het
Crym A G 7: 120,189,782 V274A probably damaging Het
Eif3l T A 15: 79,094,223 M560K probably benign Het
Fam160a1 T C 3: 85,730,746 D82G probably benign Het
Fam234b C A 6: 135,225,795 Y382* probably null Het
Fam71b A T 11: 46,404,983 I61F Het
Fbxw19 T C 9: 109,484,372 K253E possibly damaging Het
Flt3 A G 5: 147,376,980 S87P probably benign Het
Ggnbp2 A G 11: 84,834,348 L627S probably damaging Het
Gm16486 C T 8: 70,709,145 T329I possibly damaging Het
Gm26661 T G 14: 7,791,765 V60G unknown Het
Gm5065 G A 7: 5,359,528 V53I possibly damaging Het
Gm5662 T A 12: 88,271,939 N17I unknown Het
Golt1a T C 1: 133,319,356 L34P probably damaging Het
Gp5 T C 16: 30,308,990 M289V possibly damaging Het
Gpr63 C G 4: 25,008,432 H385Q possibly damaging Het
Hcn1 G A 13: 117,975,365 V622I unknown Het
Hipk4 A G 7: 27,529,409 D428G probably damaging Het
Hs3st1 T C 5: 39,614,802 Y166C probably damaging Het
Hsd17b3 A G 13: 64,058,645 F281S possibly damaging Het
Ifih1 T C 2: 62,645,606 T109A probably benign Het
Ighv1-64 T A 12: 115,508,025 probably benign Het
Ina T C 19: 47,015,377 L208P Het
Irak2 T C 6: 113,638,643 probably null Het
Klhl10 G A 11: 100,447,655 E407K probably benign Het
Krt81 A G 15: 101,463,454 S82P probably damaging Het
Ktn1 C A 14: 47,710,896 Q963K probably benign Het
Lrrc42 A T 4: 107,247,716 Y17* probably null Het
Lrrc9 A C 12: 72,449,397 E15D probably damaging Het
Mak G A 13: 41,049,363 T203I probably benign Het
Masp2 T C 4: 148,608,028 V326A possibly damaging Het
Mdc1 T C 17: 35,853,366 S1269P probably benign Het
Mink1 G A 11: 70,611,651 V1027M probably damaging Het
Mrps10 C A 17: 47,375,978 S123* probably null Het
Myl10 C T 5: 136,700,933 H142Y probably damaging Het
Ncan T C 8: 70,107,998 Q773R possibly damaging Het
Nlrp3 T A 11: 59,543,315 M68K probably damaging Het
Ntrk1 C T 3: 87,791,438 V99M possibly damaging Het
Olfr1184 C T 2: 88,487,443 T237I probably damaging Het
Olfr143 A G 9: 38,253,666 K80R probably benign Het
Olfr1434 A G 19: 12,283,575 R176G probably benign Het
Phldb2 A G 16: 45,775,074 V830A probably damaging Het
Phospho2 T C 2: 69,795,569 V23A probably damaging Het
Plxnc1 G A 10: 94,944,823 probably benign Het
Ppcdc T C 9: 57,434,997 E14G probably benign Het
Ralgapa2 T C 2: 146,460,725 Y106C probably damaging Het
Rgs22 T C 15: 36,087,398 Q582R probably benign Het
Rngtt T A 4: 33,320,613 Y53* probably null Het
Slc12a3 T G 8: 94,356,400 probably null Het
Slc26a11 A G 11: 119,376,904 T456A probably benign Het
Slc26a5 G T 5: 21,813,336 A677E possibly damaging Het
Smurf1 T C 5: 144,880,653 T690A probably benign Het
Spata24 A T 18: 35,657,011 N142K probably damaging Het
Ubqlnl A T 7: 104,149,755 N178K possibly damaging Het
Uggt2 A G 14: 119,075,329 probably null Het
Vmn1r2 C A 4: 3,172,678 A199D probably damaging Het
Vmn2r39 T C 7: 9,027,685 N128S probably damaging Het
Vmn2r61 G T 7: 42,267,195 V411F probably benign Het
Vmn2r-ps117 T A 17: 18,822,649 F106L probably benign Het
Zfp503 A T 14: 21,985,285 I521N possibly damaging Het
Zfp831 T C 2: 174,705,320 V1432A probably benign Het
Zfp981 T A 4: 146,535,427 L13I possibly damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
R8213:Efcab5 UTSW 11 77116071 missense probably damaging 1.00
R8690:Efcab5 UTSW 11 77103289 missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77121238 missense probably benign 0.03
R9310:Efcab5 UTSW 11 77113705 missense probably benign 0.23
R9404:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9405:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATCCAGCTGTGTTTGCCAC -3'
(R):5'- GCATAGCAGAATCTCAAAGAGTACC -3'

Sequencing Primer
(F):5'- ATGCTAGCAAGTGATCTGCC -3'
(R):5'- GTACCTCTTGGAGAACTGATTTTAAC -3'
Posted On 2022-04-18