Incidental Mutation 'R9325:Fer1l4'
ID 706438
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9325 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 155877934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1005 (V1005I)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611] [ENSMUST00000130764]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109611
AA Change: V1005I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: V1005I

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130764
AA Change: G57D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114324
Gene: ENSMUSG00000013338
AA Change: G57D

DomainStartEndE-ValueType
Blast:FerB 1 26 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132912
SMART Domains Protein: ENSMUSP00000123091
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,578 (GRCm39) D1076G possibly damaging Het
Aadacl2fm1 T A 3: 59,843,862 (GRCm39) N185K probably benign Het
Adamts9 T C 6: 92,849,279 (GRCm39) D1060G probably benign Het
Ahnak T A 19: 8,991,257 (GRCm39) D4180E probably benign Het
Ank2 A C 3: 126,775,504 (GRCm39) F42V probably damaging Het
Ankib1 A G 5: 3,822,523 (GRCm39) I61T possibly damaging Het
Arhgap9 T C 10: 127,161,722 (GRCm39) S238P probably damaging Het
Bpifa3 A T 2: 153,975,600 (GRCm39) I57F probably damaging Het
Cdh17 A G 4: 11,810,319 (GRCm39) Y670C probably damaging Het
Ceacam20 C A 7: 19,720,607 (GRCm39) R515S probably benign Het
Cers5 A T 15: 99,637,338 (GRCm39) V274E probably damaging Het
Clip1 T C 5: 123,751,186 (GRCm39) D865G Het
Cnih3 G A 1: 181,181,072 (GRCm39) probably null Het
Coro2b G T 9: 62,396,609 (GRCm39) H44N probably benign Het
Cuta A G 17: 27,158,289 (GRCm39) probably null Het
Dchs1 T C 7: 105,415,402 (GRCm39) I625V possibly damaging Het
Ddx4 A T 13: 112,736,441 (GRCm39) F643Y probably damaging Het
Dlc1 A T 8: 37,038,518 (GRCm39) V1020E possibly damaging Het
Dnah1 G T 14: 30,998,160 (GRCm39) T2559K possibly damaging Het
Eng C T 2: 32,561,445 (GRCm39) A152V probably damaging Het
F7 G T 8: 13,083,430 (GRCm39) R190L probably benign Het
Fcgr4 T C 1: 170,847,711 (GRCm39) V103A probably damaging Het
Fmod A T 1: 133,968,371 (GRCm39) H137L probably damaging Het
Fndc7 T C 3: 108,790,834 (GRCm39) D64G possibly damaging Het
Gucy2c A T 6: 136,743,992 (GRCm39) C202* probably null Het
Hspg2 C T 4: 137,265,552 (GRCm39) R1783W probably damaging Het
Hyal6 T A 6: 24,743,455 (GRCm39) S384T probably damaging Het
Igsf21 T A 4: 139,794,466 (GRCm39) I136F probably damaging Het
Isl1 A G 13: 116,436,105 (GRCm39) S321P probably damaging Het
Kif5c A G 2: 49,639,378 (GRCm39) K813R probably benign Het
Klk7 A G 7: 43,461,437 (GRCm39) E18G possibly damaging Het
Lox T C 18: 52,661,400 (GRCm39) M225V probably benign Het
Lrrfip2 T A 9: 110,990,429 (GRCm39) M50K possibly damaging Het
Lrrn2 A T 1: 132,865,241 (GRCm39) Q102L probably damaging Het
Mcm3 T C 1: 20,875,562 (GRCm39) R692G probably benign Het
Mmp14 T C 14: 54,676,248 (GRCm39) V326A probably damaging Het
Muc2 G A 7: 141,298,559 (GRCm39) M70I Het
Nefl T C 14: 68,322,460 (GRCm39) probably null Het
Nlrp4e C G 7: 23,020,755 (GRCm39) A414G probably benign Het
Nup188 T A 2: 30,212,271 (GRCm39) L586Q probably damaging Het
Or10ag58 G A 2: 87,265,290 (GRCm39) G153D possibly damaging Het
Or8c13 T C 9: 38,091,327 (GRCm39) D264G probably benign Het
Pik3c2a A T 7: 115,990,558 (GRCm39) D467E probably damaging Het
Polr2g T A 19: 8,774,669 (GRCm39) K71N probably benign Het
Pramel31 A G 4: 144,089,093 (GRCm39) H137R probably benign Het
Prkci A G 3: 31,085,333 (GRCm39) K184R probably damaging Het
Prr15 G A 6: 54,306,137 (GRCm39) probably benign Het
Rin2 T A 2: 145,727,819 (GRCm39) N896K probably benign Het
Ryr3 T C 2: 112,479,640 (GRCm39) E4414G probably damaging Het
Slc4a4 T A 5: 89,376,756 (GRCm39) D994E probably damaging Het
Slc6a4 C A 11: 76,909,999 (GRCm39) P418Q probably benign Het
Smarcc2 T A 10: 128,324,076 (GRCm39) M1138K unknown Het
Snph C T 2: 151,436,208 (GRCm39) R240Q probably damaging Het
Stox2 T A 8: 47,647,095 (GRCm39) T122S probably benign Het
Tmem131l T C 3: 83,817,768 (GRCm39) D1244G probably benign Het
Tmem168 T C 6: 13,583,253 (GRCm39) I543V probably benign Het
Tyw1 T C 5: 130,291,762 (GRCm39) S77P probably damaging Het
Usp36 T G 11: 118,160,031 (GRCm39) D471A possibly damaging Het
Vmn2r102 A G 17: 19,897,558 (GRCm39) Y191C probably damaging Het
Vmn2r104 T C 17: 20,268,433 (GRCm39) Q12R possibly damaging Het
Zfp820 A T 17: 22,038,380 (GRCm39) I316N probably damaging Het
Zscan4-ps3 T C 7: 11,344,227 (GRCm39) F62L probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGGGGAAGAGGTGTCT -3'
(R):5'- AGGCCCTGGTGTAGAACAG -3'

Sequencing Primer
(F):5'- AGAGGTGTCTGGAAATGGGGTG -3'
(R):5'- CCCTGGTGTAGAACAGACAGC -3'
Posted On 2022-04-18