Incidental Mutation 'R9325:Usp36'
ID 706474
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R9325 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118160031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 471 (D471A)
Ref Sequence ENSEMBL: ENSMUSP00000090036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000092382
AA Change: D471A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: D471A

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106296
AA Change: D471A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: D471A

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144153
AA Change: D306A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: D306A

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,646,578 (GRCm39) D1076G possibly damaging Het
Aadacl2fm1 T A 3: 59,843,862 (GRCm39) N185K probably benign Het
Adamts9 T C 6: 92,849,279 (GRCm39) D1060G probably benign Het
Ahnak T A 19: 8,991,257 (GRCm39) D4180E probably benign Het
Ank2 A C 3: 126,775,504 (GRCm39) F42V probably damaging Het
Ankib1 A G 5: 3,822,523 (GRCm39) I61T possibly damaging Het
Arhgap9 T C 10: 127,161,722 (GRCm39) S238P probably damaging Het
Bpifa3 A T 2: 153,975,600 (GRCm39) I57F probably damaging Het
Cdh17 A G 4: 11,810,319 (GRCm39) Y670C probably damaging Het
Ceacam20 C A 7: 19,720,607 (GRCm39) R515S probably benign Het
Cers5 A T 15: 99,637,338 (GRCm39) V274E probably damaging Het
Clip1 T C 5: 123,751,186 (GRCm39) D865G Het
Cnih3 G A 1: 181,181,072 (GRCm39) probably null Het
Coro2b G T 9: 62,396,609 (GRCm39) H44N probably benign Het
Cuta A G 17: 27,158,289 (GRCm39) probably null Het
Dchs1 T C 7: 105,415,402 (GRCm39) I625V possibly damaging Het
Ddx4 A T 13: 112,736,441 (GRCm39) F643Y probably damaging Het
Dlc1 A T 8: 37,038,518 (GRCm39) V1020E possibly damaging Het
Dnah1 G T 14: 30,998,160 (GRCm39) T2559K possibly damaging Het
Eng C T 2: 32,561,445 (GRCm39) A152V probably damaging Het
F7 G T 8: 13,083,430 (GRCm39) R190L probably benign Het
Fcgr4 T C 1: 170,847,711 (GRCm39) V103A probably damaging Het
Fer1l4 C T 2: 155,877,934 (GRCm39) V1005I probably damaging Het
Fmod A T 1: 133,968,371 (GRCm39) H137L probably damaging Het
Fndc7 T C 3: 108,790,834 (GRCm39) D64G possibly damaging Het
Gucy2c A T 6: 136,743,992 (GRCm39) C202* probably null Het
Hspg2 C T 4: 137,265,552 (GRCm39) R1783W probably damaging Het
Hyal6 T A 6: 24,743,455 (GRCm39) S384T probably damaging Het
Igsf21 T A 4: 139,794,466 (GRCm39) I136F probably damaging Het
Isl1 A G 13: 116,436,105 (GRCm39) S321P probably damaging Het
Kif5c A G 2: 49,639,378 (GRCm39) K813R probably benign Het
Klk7 A G 7: 43,461,437 (GRCm39) E18G possibly damaging Het
Lox T C 18: 52,661,400 (GRCm39) M225V probably benign Het
Lrrfip2 T A 9: 110,990,429 (GRCm39) M50K possibly damaging Het
Lrrn2 A T 1: 132,865,241 (GRCm39) Q102L probably damaging Het
Mcm3 T C 1: 20,875,562 (GRCm39) R692G probably benign Het
Mmp14 T C 14: 54,676,248 (GRCm39) V326A probably damaging Het
Muc2 G A 7: 141,298,559 (GRCm39) M70I Het
Nefl T C 14: 68,322,460 (GRCm39) probably null Het
Nlrp4e C G 7: 23,020,755 (GRCm39) A414G probably benign Het
Nup188 T A 2: 30,212,271 (GRCm39) L586Q probably damaging Het
Or10ag58 G A 2: 87,265,290 (GRCm39) G153D possibly damaging Het
Or8c13 T C 9: 38,091,327 (GRCm39) D264G probably benign Het
Pik3c2a A T 7: 115,990,558 (GRCm39) D467E probably damaging Het
Polr2g T A 19: 8,774,669 (GRCm39) K71N probably benign Het
Pramel31 A G 4: 144,089,093 (GRCm39) H137R probably benign Het
Prkci A G 3: 31,085,333 (GRCm39) K184R probably damaging Het
Prr15 G A 6: 54,306,137 (GRCm39) probably benign Het
Rin2 T A 2: 145,727,819 (GRCm39) N896K probably benign Het
Ryr3 T C 2: 112,479,640 (GRCm39) E4414G probably damaging Het
Slc4a4 T A 5: 89,376,756 (GRCm39) D994E probably damaging Het
Slc6a4 C A 11: 76,909,999 (GRCm39) P418Q probably benign Het
Smarcc2 T A 10: 128,324,076 (GRCm39) M1138K unknown Het
Snph C T 2: 151,436,208 (GRCm39) R240Q probably damaging Het
Stox2 T A 8: 47,647,095 (GRCm39) T122S probably benign Het
Tmem131l T C 3: 83,817,768 (GRCm39) D1244G probably benign Het
Tmem168 T C 6: 13,583,253 (GRCm39) I543V probably benign Het
Tyw1 T C 5: 130,291,762 (GRCm39) S77P probably damaging Het
Vmn2r102 A G 17: 19,897,558 (GRCm39) Y191C probably damaging Het
Vmn2r104 T C 17: 20,268,433 (GRCm39) Q12R possibly damaging Het
Zfp820 A T 17: 22,038,380 (GRCm39) I316N probably damaging Het
Zscan4-ps3 T C 7: 11,344,227 (GRCm39) F62L probably damaging Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0606:Usp36 UTSW 11 118,153,854 (GRCm39) splice site probably benign
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R1886:Usp36 UTSW 11 118,163,784 (GRCm39) missense probably damaging 1.00
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3768:Usp36 UTSW 11 118,153,878 (GRCm39) missense probably damaging 1.00
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R7843:Usp36 UTSW 11 118,176,791 (GRCm39) missense probably damaging 1.00
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118,175,825 (GRCm39) missense probably damaging 1.00
R9024:Usp36 UTSW 11 118,166,983 (GRCm39) missense possibly damaging 0.95
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
R9774:Usp36 UTSW 11 118,153,875 (GRCm39) missense probably damaging 1.00
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCGGGCTCATCCAGAATG -3'
(R):5'- TCTCCCGGGCAGTCATAAAC -3'

Sequencing Primer
(F):5'- CTCATCCAGAATGGTGGGCATATG -3'
(R):5'- ATATGCGTACACTGCAGCTG -3'
Posted On 2022-04-18