Mutagenetix > Incidental Mutation

Incidental Mutation 'R9325:Usp36'

706474

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R9325 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 118269205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 471 (D471A)

Ref Sequence

ENSEMBL: ENSMUSP00000090036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]

AlphaFold

B1AQJ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092382
AA Change: D471A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: D471A

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106296
AA Change: D471A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: D471A

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144153
AA Change: D306A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: D306A

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,669,619	D1076G	possibly damaging	Het
Adamts9	T	C	6: 92,872,298	D1060G	probably benign	Het
Ahnak	T	A	19: 9,013,893	D4180E	probably benign	Het
Ank2	A	C	3: 126,981,855	F42V	probably damaging	Het
Ankib1	A	G	5: 3,772,523	I61T	possibly damaging	Het
Arhgap9	T	C	10: 127,325,853	S238P	probably damaging	Het
Bpifa3	A	T	2: 154,133,680	I57F	probably damaging	Het
C130079G13Rik	T	A	3: 59,936,441	N185K	probably benign	Het
Cdh17	A	G	4: 11,810,319	Y670C	probably damaging	Het
Ceacam20	C	A	7: 19,986,682	R515S	probably benign	Het
Cers5	A	T	15: 99,739,457	V274E	probably damaging	Het
Clip1	T	C	5: 123,613,123	D865G		Het
Cnih3	G	A	1: 181,353,507		probably null	Het
Coro2b	G	T	9: 62,489,327	H44N	probably benign	Het
Cuta	A	G	17: 26,939,315		probably null	Het
Dchs1	T	C	7: 105,766,195	I625V	possibly damaging	Het
Ddx4	A	T	13: 112,599,907	F643Y	probably damaging	Het
Dlc1	A	T	8: 36,571,364	V1020E	possibly damaging	Het
Dnah1	G	T	14: 31,276,203	T2559K	possibly damaging	Het
Eng	C	T	2: 32,671,433	A152V	probably damaging	Het
F7	G	T	8: 13,033,430	R190L	probably benign	Het
Fcgr4	T	C	1: 171,020,142	V103A	probably damaging	Het
Fer1l4	C	T	2: 156,036,014	V1005I	probably damaging	Het
Fmod	A	T	1: 134,040,633	H137L	probably damaging	Het
Fndc7	T	C	3: 108,883,518	D64G	possibly damaging	Het
Gm13119	A	G	4: 144,362,523	H137R	probably benign	Het
Gucy2c	A	T	6: 136,766,994	C202*	probably null	Het
Hspg2	C	T	4: 137,538,241	R1783W	probably damaging	Het
Hyal6	T	A	6: 24,743,456	S384T	probably damaging	Het
Igsf21	T	A	4: 140,067,155	I136F	probably damaging	Het
Isl1	A	G	13: 116,299,569	S321P	probably damaging	Het
Kif5c	A	G	2: 49,749,366	K813R	probably benign	Het
Klk7	A	G	7: 43,812,013	E18G	possibly damaging	Het
Lox	T	C	18: 52,528,328	M225V	probably benign	Het
Lrrfip2	T	A	9: 111,161,361	M50K	possibly damaging	Het
Lrrn2	A	T	1: 132,937,503	Q102L	probably damaging	Het
Mcm3	T	C	1: 20,805,338	R692G	probably benign	Het
Mmp14	T	C	14: 54,438,791	V326A	probably damaging	Het
Muc2	G	A	7: 141,744,822	M70I		Het
Nefl	T	C	14: 68,085,011		probably null	Het
Nlrp4e	C	G	7: 23,321,330	A414G	probably benign	Het
Nup188	T	A	2: 30,322,259	L586Q	probably damaging	Het
Olfr1124	G	A	2: 87,434,946	G153D	possibly damaging	Het
Olfr891	T	C	9: 38,180,031	D264G	probably benign	Het
Pik3c2a	A	T	7: 116,391,323	D467E	probably damaging	Het
Polr2g	T	A	19: 8,797,305	K71N	probably benign	Het
Prkci	A	G	3: 31,031,184	K184R	probably damaging	Het
Prr15	G	A	6: 54,329,152		probably benign	Het
Rin2	T	A	2: 145,885,899	N896K	probably benign	Het
Ryr3	T	C	2: 112,649,295	E4414G	probably damaging	Het
Slc4a4	T	A	5: 89,228,897	D994E	probably damaging	Het
Slc6a4	C	A	11: 77,019,173	P418Q	probably benign	Het
Smarcc2	T	A	10: 128,488,207	M1138K	unknown	Het
Snph	C	T	2: 151,594,288	R240Q	probably damaging	Het
Stox2	T	A	8: 47,194,060	T122S	probably benign	Het
Tmem131l	T	C	3: 83,910,461	D1244G	probably benign	Het
Tmem168	T	C	6: 13,583,254	I543V	probably benign	Het
Tyw1	T	C	5: 130,262,921	S77P	probably damaging	Het
Vmn2r102	A	G	17: 19,677,296	Y191C	probably damaging	Het
Vmn2r104	T	C	17: 20,048,171	Q12R	possibly damaging	Het
Zfp820	A	T	17: 21,819,399	I316N	probably damaging	Het
Zscan4-ps3	T	C	7: 11,610,300	F62L	probably damaging	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118273571	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118285023	missense	possibly damaging	0.95
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118263052	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118268585	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118273529	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
R8902:Usp36	UTSW	11	118275014	missense	probably damaging	1.00
R8935:Usp36	UTSW	11	118276831	critical splice acceptor site	probably null
R8995:Usp36	UTSW	11	118284999	missense	probably damaging	1.00
R9024:Usp36	UTSW	11	118276157	missense	possibly damaging	0.95
R9529:Usp36	UTSW	11	118268635	nonsense	probably null
R9774:Usp36	UTSW	11	118263049	missense	probably damaging	1.00
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCGGGCTCATCCAGAATG -3'
(R):5'- TCTCCCGGGCAGTCATAAAC -3'

Sequencing Primer
(F):5'- CTCATCCAGAATGGTGGGCATATG -3'
(R):5'- ATATGCGTACACTGCAGCTG -3'

Posted On

2022-04-18