Mutagenetix > Incidental Mutation

Incidental Mutation 'R9325:Isl1'

706476

Institutional Source

Beutler Lab

Gene Symbol

Isl1

Ensembl Gene

ENSMUSG00000042258

Gene Name

ISL1 transcription factor, LIM/homeodomain

Synonyms

Islet 1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9325 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116434817-116446225 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116436105 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 321 (S321P)

Ref Sequence

ENSEMBL: ENSMUSP00000044879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036060] [ENSMUST00000176044]

AlphaFold

P61372

PDB Structure

Crystal Structure of Lhx3 LIM domains 1 and 2 with the binding domain of Isl1 [X-RAY DIFFRACTION]
Crystal structure of Isl1 LIM domains with Ldb1 LIM-interaction domain [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036060
AA Change: S321P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000044879
Gene: ENSMUSG00000042258
AA Change: S321P

Domain	Start	End	E-Value	Type
LIM	16	70	1.39e-13	SMART
LIM	78	132	4.99e-15	SMART
HOX	181	243	1.83e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176044
AA Change: S298P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135567
Gene: ENSMUSG00000042258
AA Change: S298P

Domain	Start	End	E-Value	Type
LIM	16	70	1.39e-13	SMART
LIM	78	132	4.99e-15	SMART
HOX	181	243	1.83e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to develop motor neurons and die by embryonic day 11.5 with abnormal heart and pancreas development. Mice heterozygous for an ENU mutation exhibit chronic otitis media and hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,646,578 (GRCm39)	D1076G	possibly damaging	Het
Aadacl2fm1	T	A	3: 59,843,862 (GRCm39)	N185K	probably benign	Het
Adamts9	T	C	6: 92,849,279 (GRCm39)	D1060G	probably benign	Het
Ahnak	T	A	19: 8,991,257 (GRCm39)	D4180E	probably benign	Het
Ank2	A	C	3: 126,775,504 (GRCm39)	F42V	probably damaging	Het
Ankib1	A	G	5: 3,822,523 (GRCm39)	I61T	possibly damaging	Het
Arhgap9	T	C	10: 127,161,722 (GRCm39)	S238P	probably damaging	Het
Bpifa3	A	T	2: 153,975,600 (GRCm39)	I57F	probably damaging	Het
Cdh17	A	G	4: 11,810,319 (GRCm39)	Y670C	probably damaging	Het
Ceacam20	C	A	7: 19,720,607 (GRCm39)	R515S	probably benign	Het
Cers5	A	T	15: 99,637,338 (GRCm39)	V274E	probably damaging	Het
Clip1	T	C	5: 123,751,186 (GRCm39)	D865G		Het
Cnih3	G	A	1: 181,181,072 (GRCm39)		probably null	Het
Coro2b	G	T	9: 62,396,609 (GRCm39)	H44N	probably benign	Het
Cuta	A	G	17: 27,158,289 (GRCm39)		probably null	Het
Dchs1	T	C	7: 105,415,402 (GRCm39)	I625V	possibly damaging	Het
Ddx4	A	T	13: 112,736,441 (GRCm39)	F643Y	probably damaging	Het
Dlc1	A	T	8: 37,038,518 (GRCm39)	V1020E	possibly damaging	Het
Dnah1	G	T	14: 30,998,160 (GRCm39)	T2559K	possibly damaging	Het
Eng	C	T	2: 32,561,445 (GRCm39)	A152V	probably damaging	Het
F7	G	T	8: 13,083,430 (GRCm39)	R190L	probably benign	Het
Fcgr4	T	C	1: 170,847,711 (GRCm39)	V103A	probably damaging	Het
Fer1l4	C	T	2: 155,877,934 (GRCm39)	V1005I	probably damaging	Het
Fmod	A	T	1: 133,968,371 (GRCm39)	H137L	probably damaging	Het
Fndc7	T	C	3: 108,790,834 (GRCm39)	D64G	possibly damaging	Het
Gucy2c	A	T	6: 136,743,992 (GRCm39)	C202*	probably null	Het
Hspg2	C	T	4: 137,265,552 (GRCm39)	R1783W	probably damaging	Het
Hyal6	T	A	6: 24,743,455 (GRCm39)	S384T	probably damaging	Het
Igsf21	T	A	4: 139,794,466 (GRCm39)	I136F	probably damaging	Het
Kif5c	A	G	2: 49,639,378 (GRCm39)	K813R	probably benign	Het
Klk7	A	G	7: 43,461,437 (GRCm39)	E18G	possibly damaging	Het
Lox	T	C	18: 52,661,400 (GRCm39)	M225V	probably benign	Het
Lrrfip2	T	A	9: 110,990,429 (GRCm39)	M50K	possibly damaging	Het
Lrrn2	A	T	1: 132,865,241 (GRCm39)	Q102L	probably damaging	Het
Mcm3	T	C	1: 20,875,562 (GRCm39)	R692G	probably benign	Het
Mmp14	T	C	14: 54,676,248 (GRCm39)	V326A	probably damaging	Het
Muc2	G	A	7: 141,298,559 (GRCm39)	M70I		Het
Nefl	T	C	14: 68,322,460 (GRCm39)		probably null	Het
Nlrp4e	C	G	7: 23,020,755 (GRCm39)	A414G	probably benign	Het
Nup188	T	A	2: 30,212,271 (GRCm39)	L586Q	probably damaging	Het
Or10ag58	G	A	2: 87,265,290 (GRCm39)	G153D	possibly damaging	Het
Or8c13	T	C	9: 38,091,327 (GRCm39)	D264G	probably benign	Het
Pik3c2a	A	T	7: 115,990,558 (GRCm39)	D467E	probably damaging	Het
Polr2g	T	A	19: 8,774,669 (GRCm39)	K71N	probably benign	Het
Pramel31	A	G	4: 144,089,093 (GRCm39)	H137R	probably benign	Het
Prkci	A	G	3: 31,085,333 (GRCm39)	K184R	probably damaging	Het
Prr15	G	A	6: 54,306,137 (GRCm39)		probably benign	Het
Rin2	T	A	2: 145,727,819 (GRCm39)	N896K	probably benign	Het
Ryr3	T	C	2: 112,479,640 (GRCm39)	E4414G	probably damaging	Het
Slc4a4	T	A	5: 89,376,756 (GRCm39)	D994E	probably damaging	Het
Slc6a4	C	A	11: 76,909,999 (GRCm39)	P418Q	probably benign	Het
Smarcc2	T	A	10: 128,324,076 (GRCm39)	M1138K	unknown	Het
Snph	C	T	2: 151,436,208 (GRCm39)	R240Q	probably damaging	Het
Stox2	T	A	8: 47,647,095 (GRCm39)	T122S	probably benign	Het
Tmem131l	T	C	3: 83,817,768 (GRCm39)	D1244G	probably benign	Het
Tmem168	T	C	6: 13,583,253 (GRCm39)	I543V	probably benign	Het
Tyw1	T	C	5: 130,291,762 (GRCm39)	S77P	probably damaging	Het
Usp36	T	G	11: 118,160,031 (GRCm39)	D471A	possibly damaging	Het
Vmn2r102	A	G	17: 19,897,558 (GRCm39)	Y191C	probably damaging	Het
Vmn2r104	T	C	17: 20,268,433 (GRCm39)	Q12R	possibly damaging	Het
Zfp820	A	T	17: 22,038,380 (GRCm39)	I316N	probably damaging	Het
Zscan4-ps3	T	C	7: 11,344,227 (GRCm39)	F62L	probably damaging	Het

Other mutations in Isl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Isl1	APN	13	116,439,589 (GRCm39)	missense	probably benign	0.02
IGL03251:Isl1	APN	13	116,441,985 (GRCm39)	missense	probably benign
R1897:Isl1	UTSW	13	116,439,866 (GRCm39)	missense	probably benign	0.12
R1928:Isl1	UTSW	13	116,444,953 (GRCm39)	missense	probably damaging	1.00
R2940:Isl1	UTSW	13	116,444,835 (GRCm39)	missense	possibly damaging	0.53
R4062:Isl1	UTSW	13	116,439,626 (GRCm39)	missense	probably benign	0.27
R4795:Isl1	UTSW	13	116,441,966 (GRCm39)	missense	probably benign	0.41
R4796:Isl1	UTSW	13	116,441,966 (GRCm39)	missense	probably benign	0.41
R4836:Isl1	UTSW	13	116,439,619 (GRCm39)	missense	probably benign	0.06
R4839:Isl1	UTSW	13	116,438,220 (GRCm39)	missense	probably damaging	1.00
R4870:Isl1	UTSW	13	116,444,806 (GRCm39)	splice site	probably benign
R5231:Isl1	UTSW	13	116,438,193 (GRCm39)	missense	probably benign	0.17
R6220:Isl1	UTSW	13	116,439,803 (GRCm39)	missense	probably benign	0.24
R7231:Isl1	UTSW	13	116,439,826 (GRCm39)	missense	probably benign	0.06
R8191:Isl1	UTSW	13	116,441,954 (GRCm39)	missense	probably benign
R8493:Isl1	UTSW	13	116,441,835 (GRCm39)	missense	possibly damaging	0.88
R8969:Isl1	UTSW	13	116,439,857 (GRCm39)	missense	possibly damaging	0.70
R9273:Isl1	UTSW	13	116,444,902 (GRCm39)	nonsense	probably null
R9614:Isl1	UTSW	13	116,441,924 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- ATTTCGGAGTTCAACGTCATTTCC -3'
(R):5'- GGAGAGCATTTCTTTGCAAGTG -3'

Sequencing Primer
(F):5'- CCACTTTCTCCAACAGGGG -3'
(R):5'- GCAAGTGCTTCTCCTGGG -3'

Posted On

2022-04-18