Mutagenetix > Incidental Mutation

Incidental Mutation 'R0740:Crabp2'

70648

Institutional Source

Beutler Lab

Gene Symbol

Crabp2

Ensembl Gene

ENSMUSG00000004885

Gene Name

cellular retinoic acid binding protein II

Synonyms

Crabp-2, CrabpII

MMRRC Submission

038921-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.750) question?

Stock #

R0740 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87856000-87860679 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87859443 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 31 (K31R)

Ref Sequence

ENSEMBL: ENSMUSP00000005019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005019]

AlphaFold

P22935

Predicted Effect

probably benign
Transcript: ENSMUST00000005019
AA Change: K31R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000005019
Gene: ENSMUSG00000004885
AA Change: K31R

Domain	Start	End	E-Value	Type
Pfam:Lipocalin_7	2	136	1.1e-9	PFAM
Pfam:Lipocalin	5	138	4.8e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163040

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.2%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoic acid (RA, a form of vitamin A) binding protein family and lipocalin/cytosolic fatty-acid binding protein family. The protein is a cytosol-to-nuclear shuttling protein, which facilitates RA binding to its cognate receptor complex and transfer to the nucleus. It is involved in the retinoid signaling pathway, and is associated with increased circulating low-density lipoprotein cholesterol. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations may exhibit an additional postaxial digit, usually on a single forepaw. Penetrance is dependent on the genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aoc3	G	T	11: 101,223,158 (GRCm39)	V465L	probably benign	Het
C2cd5	T	A	6: 142,981,989 (GRCm39)	N625I	probably damaging	Het
Ccdc60	T	A	5: 116,328,135 (GRCm39)	R110W	probably damaging	Het
Cfap43	A	G	19: 47,824,243 (GRCm39)	F43L	possibly damaging	Het
Get1	G	C	16: 95,946,798 (GRCm39)		probably benign	Het
Mib2	C	T	4: 155,743,917 (GRCm39)	G42S	probably damaging	Het
Nlrp3	T	C	11: 59,439,082 (GRCm39)	F220L	probably benign	Het
Pik3c2g	T	C	6: 139,610,791 (GRCm39)		probably null	Het
Rragc	A	G	4: 123,818,556 (GRCm39)	K257R	probably damaging	Het
Scml4	T	C	10: 42,806,559 (GRCm39)	F149S	probably damaging	Het
Tdrd1	A	G	19: 56,827,531 (GRCm39)	K178R	probably damaging	Het
Trappc11	A	T	8: 47,977,623 (GRCm39)	V224D	probably damaging	Het
Zfp964	G	T	8: 70,115,828 (GRCm39)	D143Y	probably damaging	Het

Other mutations in Crabp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Crabp2	APN	3	87,859,506 (GRCm39)	missense	probably damaging	1.00
R0384:Crabp2	UTSW	3	87,860,328 (GRCm39)	missense	possibly damaging	0.90
R1776:Crabp2	UTSW	3	87,860,301 (GRCm39)	missense	probably benign	0.01
R1956:Crabp2	UTSW	3	87,856,193 (GRCm39)	missense	probably damaging	0.97
R3161:Crabp2	UTSW	3	87,859,484 (GRCm39)	nonsense	probably null
R7410:Crabp2	UTSW	3	87,859,585 (GRCm39)	missense	probably damaging	1.00
R9302:Crabp2	UTSW	3	87,859,833 (GRCm39)	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CCTAAGGGTGCTAGGAATGTGTTGC -3'
(R):5'- CACCAGGATCAGCTCTCCATCATTG -3'

Sequencing Primer
(F):5'- GGGTCATATAGCCTGCCTCAC -3'
(R):5'- CAAGTAGGTGCTGTGACGC -3'

Posted On

2013-09-30