Mutagenetix > Incidental Mutation

Incidental Mutation 'R0740:Rragc'

70650

Institutional Source

Beutler Lab

Gene Symbol

Rragc

Ensembl Gene

ENSMUSG00000028646

Gene Name

Ras-related GTP binding C

Synonyms

YGR163W, TIB929, Gtr2

MMRRC Submission

038921-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R0740 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123811239-123830790 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123818556 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 257 (K257R)

Ref Sequence

ENSEMBL: ENSMUSP00000030399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030399] [ENSMUST00000155757]

AlphaFold

Q99K70

Predicted Effect

probably damaging
Transcript: ENSMUST00000030399
AA Change: K257R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030399
Gene: ENSMUSG00000028646
AA Change: K257R

Domain	Start	End	E-Value	Type
Pfam:Arf	55	234	5.1e-7	PFAM
Pfam:SRPRB	58	154	9.8e-7	PFAM
Pfam:Gtr1_RagA	62	288	2.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118389

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133445

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143635

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155454

Predicted Effect

probably benign
Transcript: ENSMUST00000155757

SMART Domains

Protein: ENSMUSP00000115232
Gene: ENSMUSG00000028646

Domain	Start	End	E-Value	Type
Pfam:Arf	55	157	1.7e-6	PFAM
Pfam:SRPRB	58	156	6.3e-8	PFAM
Pfam:Gtr1_RagA	62	178	1.5e-30	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.2%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTR/RAG GTP-binding protein family. The encoded protein is a monomeric guanine nucleotide-binding protein which forms a heterodimer with RRAGA and RRAGB and is primarily localized to the cytoplasm. The encoded protein promotes intracellular localization of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aoc3	G	T	11: 101,223,158 (GRCm39)	V465L	probably benign	Het
C2cd5	T	A	6: 142,981,989 (GRCm39)	N625I	probably damaging	Het
Ccdc60	T	A	5: 116,328,135 (GRCm39)	R110W	probably damaging	Het
Cfap43	A	G	19: 47,824,243 (GRCm39)	F43L	possibly damaging	Het
Crabp2	A	G	3: 87,859,443 (GRCm39)	K31R	probably benign	Het
Get1	G	C	16: 95,946,798 (GRCm39)		probably benign	Het
Mib2	C	T	4: 155,743,917 (GRCm39)	G42S	probably damaging	Het
Nlrp3	T	C	11: 59,439,082 (GRCm39)	F220L	probably benign	Het
Pik3c2g	T	C	6: 139,610,791 (GRCm39)		probably null	Het
Scml4	T	C	10: 42,806,559 (GRCm39)	F149S	probably damaging	Het
Tdrd1	A	G	19: 56,827,531 (GRCm39)	K178R	probably damaging	Het
Trappc11	A	T	8: 47,977,623 (GRCm39)	V224D	probably damaging	Het
Zfp964	G	T	8: 70,115,828 (GRCm39)	D143Y	probably damaging	Het

Other mutations in Rragc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00918:Rragc	APN	4	123,813,636 (GRCm39)	unclassified	probably benign
IGL01067:Rragc	APN	4	123,823,761 (GRCm39)	missense	probably benign	0.12
IGL01843:Rragc	APN	4	123,814,852 (GRCm39)	missense	probably damaging	1.00
IGL02302:Rragc	APN	4	123,814,879 (GRCm39)	missense	possibly damaging	0.65
IGL02368:Rragc	APN	4	123,814,904 (GRCm39)	missense	probably benign	0.11
R0988:Rragc	UTSW	4	123,818,575 (GRCm39)	splice site	probably null
R4620:Rragc	UTSW	4	123,818,622 (GRCm39)	missense	probably damaging	0.98
R5169:Rragc	UTSW	4	123,829,457 (GRCm39)	missense	probably damaging	0.96
R5727:Rragc	UTSW	4	123,813,828 (GRCm39)	missense	possibly damaging	0.66
R5729:Rragc	UTSW	4	123,818,645 (GRCm39)	missense	possibly damaging	0.60
R5959:Rragc	UTSW	4	123,817,767 (GRCm39)	missense	probably damaging	1.00
R6197:Rragc	UTSW	4	123,811,340 (GRCm39)	missense	possibly damaging	0.90
R7860:Rragc	UTSW	4	123,823,717 (GRCm39)	missense	probably damaging	0.99
R8008:Rragc	UTSW	4	123,829,340 (GRCm39)	missense	probably damaging	0.96
R9748:Rragc	UTSW	4	123,818,658 (GRCm39)	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GAAGGTTGGATGGAAGTACTGCTTAGC -3'
(R):5'- ACCTGCCTGGAATCTTGCAGAAATG -3'

Sequencing Primer
(F):5'- agttttacagcatcctcctcc -3'
(R):5'- GCAGAAATGTGTAAGCACTTACC -3'

Posted On

2013-09-30