Incidental Mutation 'R9326:Olfr847'
ID 706525
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Name olfactory receptor 847
Synonyms MOR149-2, GA_x6K02T2PVTD-13113073-13112135
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19373668-19378669 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19375050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 277 (M277K)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
AlphaFold Q8VFF4
Predicted Effect probably damaging
Transcript: ENSMUST00000079620
AA Change: M277K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: M277K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216839
AA Change: M277K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik C T 3: 108,544,615 R159W probably damaging Het
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
Adamts14 A G 10: 61,200,459 S1015P probably benign Het
Adamts8 A G 9: 30,943,590 T252A probably benign Het
Adamtsl1 T A 4: 86,232,567 S149T possibly damaging Het
Afp A G 5: 90,504,346 K399E probably damaging Het
Atp8b1 T A 18: 64,573,273 S222C probably damaging Het
C330027C09Rik G A 16: 49,013,872 probably null Het
Ccdc88c C A 12: 101,028,850 probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cluh A G 11: 74,664,076 K780R probably benign Het
Cope C A 8: 70,302,866 F20L possibly damaging Het
Cps1 G T 1: 67,209,636 R1174L probably damaging Het
Csmd1 G A 8: 15,999,803 T2271I probably benign Het
Ctbp2 A G 7: 133,014,630 I192T probably benign Het
Dcun1d4 A G 5: 73,522,675 T106A probably benign Het
Ddb2 A T 2: 91,217,214 M240K probably benign Het
Ddx20 A T 3: 105,684,419 V145D probably damaging Het
Ddx31 A G 2: 28,858,996 D268G probably damaging Het
Drc7 A G 8: 95,075,258 I716V probably benign Het
Epb41l4a G T 18: 33,828,208 Y424* probably null Het
Exog A G 9: 119,462,488 N277S probably damaging Het
Fzd7 T C 1: 59,483,678 L240P possibly damaging Het
Gpr87 T C 3: 59,179,188 T299A probably damaging Het
Hecw2 A G 1: 54,040,210 Y95H probably damaging Het
Idh1 T C 1: 65,166,257 Y183C probably damaging Het
Ighv14-4 T A 12: 114,176,849 I7F possibly damaging Het
Il1rap A T 16: 26,676,891 I83F probably damaging Het
Jag1 A G 2: 137,089,825 S609P probably benign Het
Klhl33 T C 14: 50,897,158 E9G possibly damaging Het
Lama2 A G 10: 27,030,197 F2421L probably benign Het
Lmod2 A T 6: 24,598,000 I40F probably damaging Het
Lsm5 A T 6: 56,704,631 L13Q possibly damaging Het
Man2c1 G T 9: 57,135,620 C258F probably damaging Het
Mgst1 T C 6: 138,143,025 S28P probably benign Het
Msh3 A T 13: 92,263,799 V744E probably benign Het
Mtx2 C T 2: 74,825,943 probably benign Het
N4bp3 C T 11: 51,644,486 R292H probably benign Het
Neto2 A T 8: 85,642,434 W354R probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nutm1 A T 2: 112,248,347 S1074R possibly damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1110 T C 2: 87,136,303 H6R probably benign Het
Olfr1118 T A 2: 87,309,386 M219K probably benign Het
Olfr281 T C 15: 98,457,054 V248A probably damaging Het
Pi4kb T A 3: 94,993,195 probably null Het
Rgsl1 C T 1: 153,804,022 D103N probably benign Het
Rrbp1 G A 2: 143,964,824 T958M probably damaging Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Setd2 T C 9: 110,549,603 C829R probably benign Het
Snd1 A T 6: 28,795,843 R562* probably null Het
Snx27 A T 3: 94,502,062 Y526N probably damaging Het
Stab2 A G 10: 86,955,146 L483P probably damaging Het
Sybu A G 15: 44,673,623 S436P probably damaging Het
Thy1 A G 9: 44,046,686 D37G probably damaging Het
Tmed8 A T 12: 87,174,621 I126N probably damaging Het
Tmem161b T A 13: 84,292,483 L340* probably null Het
Tpr C T 1: 150,425,656 A1331V possibly damaging Het
Tprg G A 16: 25,317,357 E33K probably benign Het
Vps26b T C 9: 27,019,331 N123D probably damaging Het
Wdr7 G A 18: 63,739,189 S398N probably benign Het
Zbtb48 T C 4: 152,027,052 D2G probably damaging Het
Zfp975 G A 7: 42,662,413 R259* probably null Het
Zfp986 T A 4: 145,899,881 H370Q probably damaging Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
R7246:Olfr847 UTSW 9 19375465 nonsense probably null
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7886:Olfr847 UTSW 9 19375906 splice site probably null
R8948:Olfr847 UTSW 9 19374966 missense probably benign 0.03
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAAGAATTCTGCCTCTATGG -3'
(R):5'- TCAAGCTTGCCTGTTCTGATAC -3'

Sequencing Primer
(F):5'- TGCCTCTATGGAAGACATGAAC -3'
(R):5'- GCAACATTTATATTTGGTGGAATTCC -3'
Posted On 2022-04-18