Incidental Mutation 'R9326:Cluh'
ID 706538
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Name clustered mitochondria (cluA/CLU1) homolog
Synonyms 1300001I01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock # R9326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 74649495-74670847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74664076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 780 (K780R)
Ref Sequence ENSEMBL: ENSMUSP00000090593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092915
AA Change: K780R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: K780R

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117818
AA Change: K780R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: K780R

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik C T 3: 108,544,615 R159W probably damaging Het
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
Adamts14 A G 10: 61,200,459 S1015P probably benign Het
Adamts8 A G 9: 30,943,590 T252A probably benign Het
Adamtsl1 T A 4: 86,232,567 S149T possibly damaging Het
Afp A G 5: 90,504,346 K399E probably damaging Het
Atp8b1 T A 18: 64,573,273 S222C probably damaging Het
C330027C09Rik G A 16: 49,013,872 probably null Het
Ccdc88c C A 12: 101,028,850 probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cope C A 8: 70,302,866 F20L possibly damaging Het
Cps1 G T 1: 67,209,636 R1174L probably damaging Het
Csmd1 G A 8: 15,999,803 T2271I probably benign Het
Ctbp2 A G 7: 133,014,630 I192T probably benign Het
Dcun1d4 A G 5: 73,522,675 T106A probably benign Het
Ddb2 A T 2: 91,217,214 M240K probably benign Het
Ddx20 A T 3: 105,684,419 V145D probably damaging Het
Ddx31 A G 2: 28,858,996 D268G probably damaging Het
Drc7 A G 8: 95,075,258 I716V probably benign Het
Epb41l4a G T 18: 33,828,208 Y424* probably null Het
Exog A G 9: 119,462,488 N277S probably damaging Het
Fzd7 T C 1: 59,483,678 L240P possibly damaging Het
Gpr87 T C 3: 59,179,188 T299A probably damaging Het
Hecw2 A G 1: 54,040,210 Y95H probably damaging Het
Idh1 T C 1: 65,166,257 Y183C probably damaging Het
Ighv14-4 T A 12: 114,176,849 I7F possibly damaging Het
Il1rap A T 16: 26,676,891 I83F probably damaging Het
Jag1 A G 2: 137,089,825 S609P probably benign Het
Klhl33 T C 14: 50,897,158 E9G possibly damaging Het
Lama2 A G 10: 27,030,197 F2421L probably benign Het
Lmod2 A T 6: 24,598,000 I40F probably damaging Het
Lsm5 A T 6: 56,704,631 L13Q possibly damaging Het
Man2c1 G T 9: 57,135,620 C258F probably damaging Het
Mgst1 T C 6: 138,143,025 S28P probably benign Het
Msh3 A T 13: 92,263,799 V744E probably benign Het
Mtx2 C T 2: 74,825,943 probably benign Het
N4bp3 C T 11: 51,644,486 R292H probably benign Het
Neto2 A T 8: 85,642,434 W354R probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nutm1 A T 2: 112,248,347 S1074R possibly damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1110 T C 2: 87,136,303 H6R probably benign Het
Olfr1118 T A 2: 87,309,386 M219K probably benign Het
Olfr281 T C 15: 98,457,054 V248A probably damaging Het
Olfr847 A T 9: 19,375,050 M277K probably damaging Het
Pi4kb T A 3: 94,993,195 probably null Het
Rgsl1 C T 1: 153,804,022 D103N probably benign Het
Rrbp1 G A 2: 143,964,824 T958M probably damaging Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Setd2 T C 9: 110,549,603 C829R probably benign Het
Snd1 A T 6: 28,795,843 R562* probably null Het
Snx27 A T 3: 94,502,062 Y526N probably damaging Het
Stab2 A G 10: 86,955,146 L483P probably damaging Het
Sybu A G 15: 44,673,623 S436P probably damaging Het
Thy1 A G 9: 44,046,686 D37G probably damaging Het
Tmed8 A T 12: 87,174,621 I126N probably damaging Het
Tmem161b T A 13: 84,292,483 L340* probably null Het
Tpr C T 1: 150,425,656 A1331V possibly damaging Het
Tprg G A 16: 25,317,357 E33K probably benign Het
Vps26b T C 9: 27,019,331 N123D probably damaging Het
Wdr7 G A 18: 63,739,189 S398N probably benign Het
Zbtb48 T C 4: 152,027,052 D2G probably damaging Het
Zfp975 G A 7: 42,662,413 R259* probably null Het
Zfp986 T A 4: 145,899,881 H370Q probably damaging Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 splice site probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7225:Cluh UTSW 11 74666406 splice site probably null
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
R7674:Cluh UTSW 11 74667720 missense probably damaging 1.00
R7941:Cluh UTSW 11 74659757 missense probably benign 0.00
R9061:Cluh UTSW 11 74660366 missense possibly damaging 0.73
RF020:Cluh UTSW 11 74669538 small insertion probably benign
RF032:Cluh UTSW 11 74669515 small insertion probably benign
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Z1177:Cluh UTSW 11 74667754 missense possibly damaging 0.82
Z1186:Cluh UTSW 11 74669517 small insertion probably benign
Z1186:Cluh UTSW 11 74669531 small insertion probably benign
Z1187:Cluh UTSW 11 74669514 small insertion probably benign
Z1187:Cluh UTSW 11 74669516 small insertion probably benign
Z1187:Cluh UTSW 11 74669517 small insertion probably benign
Z1187:Cluh UTSW 11 74669520 small insertion probably benign
Z1187:Cluh UTSW 11 74669521 small insertion probably benign
Z1187:Cluh UTSW 11 74669524 small insertion probably benign
Z1187:Cluh UTSW 11 74669529 small insertion probably benign
Z1188:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669514 frame shift probably null
Z1189:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669519 small insertion probably benign
Z1189:Cluh UTSW 11 74669523 small insertion probably benign
Z1189:Cluh UTSW 11 74669529 small insertion probably benign
Z1189:Cluh UTSW 11 74669530 nonsense probably null
Z1189:Cluh UTSW 11 74669531 small insertion probably benign
Z1190:Cluh UTSW 11 74669517 small insertion probably benign
Z1190:Cluh UTSW 11 74669518 small insertion probably benign
Z1190:Cluh UTSW 11 74669530 small insertion probably benign
Z1190:Cluh UTSW 11 74669532 small insertion probably benign
Z1191:Cluh UTSW 11 74669514 small insertion probably benign
Z1191:Cluh UTSW 11 74669517 small insertion probably benign
Z1191:Cluh UTSW 11 74669523 small insertion probably benign
Z1191:Cluh UTSW 11 74669526 small insertion probably benign
Z1191:Cluh UTSW 11 74669530 small insertion probably benign
Z1192:Cluh UTSW 11 74669517 small insertion probably benign
Z1192:Cluh UTSW 11 74669525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTCCCCAGGCAAGTAAGAATG -3'
(R):5'- CTTTGACTTATTGGGCACTGC -3'

Sequencing Primer
(F):5'- TGGATAATCAGTGAGTGAACCCTGC -3'
(R):5'- CAGTGTGCCAGGCTAGGAG -3'
Posted On 2022-04-18