Incidental Mutation 'R9326:Sybu'
ID 706546
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Name syntabulin (syntaxin-interacting)
Synonyms A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R9326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 44671856-44788063 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44673623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 436 (S436P)
Ref Sequence ENSEMBL: ENSMUSP00000087511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]
AlphaFold Q8BHS8
Predicted Effect probably damaging
Transcript: ENSMUST00000090057
AA Change: S436P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: S436P

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110267
AA Change: S308P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: S308P

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110269
AA Change: S236P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: S236P

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect probably damaging
Transcript: ENSMUST00000227305
AA Change: S307P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228057
AA Change: S308P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik C T 3: 108,544,615 R159W probably damaging Het
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
Adamts14 A G 10: 61,200,459 S1015P probably benign Het
Adamts8 A G 9: 30,943,590 T252A probably benign Het
Adamtsl1 T A 4: 86,232,567 S149T possibly damaging Het
Afp A G 5: 90,504,346 K399E probably damaging Het
Atp8b1 T A 18: 64,573,273 S222C probably damaging Het
C330027C09Rik G A 16: 49,013,872 probably null Het
Ccdc88c C A 12: 101,028,850 probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cluh A G 11: 74,664,076 K780R probably benign Het
Cope C A 8: 70,302,866 F20L possibly damaging Het
Cps1 G T 1: 67,209,636 R1174L probably damaging Het
Csmd1 G A 8: 15,999,803 T2271I probably benign Het
Ctbp2 A G 7: 133,014,630 I192T probably benign Het
Dcun1d4 A G 5: 73,522,675 T106A probably benign Het
Ddb2 A T 2: 91,217,214 M240K probably benign Het
Ddx20 A T 3: 105,684,419 V145D probably damaging Het
Ddx31 A G 2: 28,858,996 D268G probably damaging Het
Drc7 A G 8: 95,075,258 I716V probably benign Het
Epb41l4a G T 18: 33,828,208 Y424* probably null Het
Exog A G 9: 119,462,488 N277S probably damaging Het
Fzd7 T C 1: 59,483,678 L240P possibly damaging Het
Gpr87 T C 3: 59,179,188 T299A probably damaging Het
Hecw2 A G 1: 54,040,210 Y95H probably damaging Het
Idh1 T C 1: 65,166,257 Y183C probably damaging Het
Ighv14-4 T A 12: 114,176,849 I7F possibly damaging Het
Il1rap A T 16: 26,676,891 I83F probably damaging Het
Jag1 A G 2: 137,089,825 S609P probably benign Het
Klhl33 T C 14: 50,897,158 E9G possibly damaging Het
Lama2 A G 10: 27,030,197 F2421L probably benign Het
Lmod2 A T 6: 24,598,000 I40F probably damaging Het
Lsm5 A T 6: 56,704,631 L13Q possibly damaging Het
Man2c1 G T 9: 57,135,620 C258F probably damaging Het
Mgst1 T C 6: 138,143,025 S28P probably benign Het
Msh3 A T 13: 92,263,799 V744E probably benign Het
Mtx2 C T 2: 74,825,943 probably benign Het
N4bp3 C T 11: 51,644,486 R292H probably benign Het
Neto2 A T 8: 85,642,434 W354R probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Nup98 C A 7: 102,138,830 R1011L probably benign Het
Nutm1 A T 2: 112,248,347 S1074R possibly damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1110 T C 2: 87,136,303 H6R probably benign Het
Olfr1118 T A 2: 87,309,386 M219K probably benign Het
Olfr281 T C 15: 98,457,054 V248A probably damaging Het
Olfr847 A T 9: 19,375,050 M277K probably damaging Het
Pi4kb T A 3: 94,993,195 probably null Het
Rgsl1 C T 1: 153,804,022 D103N probably benign Het
Rrbp1 G A 2: 143,964,824 T958M probably damaging Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Setd2 T C 9: 110,549,603 C829R probably benign Het
Snd1 A T 6: 28,795,843 R562* probably null Het
Snx27 A T 3: 94,502,062 Y526N probably damaging Het
Stab2 A G 10: 86,955,146 L483P probably damaging Het
Thy1 A G 9: 44,046,686 D37G probably damaging Het
Tmed8 A T 12: 87,174,621 I126N probably damaging Het
Tmem161b T A 13: 84,292,483 L340* probably null Het
Tpr C T 1: 150,425,656 A1331V possibly damaging Het
Tprg G A 16: 25,317,357 E33K probably benign Het
Vps26b T C 9: 27,019,331 N123D probably damaging Het
Wdr7 G A 18: 63,739,189 S398N probably benign Het
Zbtb48 T C 4: 152,027,052 D2G probably damaging Het
Zfp975 G A 7: 42,662,413 R259* probably null Het
Zfp986 T A 4: 145,899,881 H370Q probably damaging Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44672805 missense probably damaging 1.00
IGL02211:Sybu APN 15 44673466 missense probably damaging 1.00
IGL02303:Sybu APN 15 44673223 missense probably benign 0.03
E7848:Sybu UTSW 15 44673422 missense probably benign 0.32
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0413:Sybu UTSW 15 44673272 missense probably damaging 1.00
R0650:Sybu UTSW 15 44673268 missense probably benign 0.08
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1307:Sybu UTSW 15 44675390 missense probably damaging 1.00
R1568:Sybu UTSW 15 44718832 nonsense probably null
R2112:Sybu UTSW 15 44673335 missense probably benign 0.06
R2967:Sybu UTSW 15 44746356 missense probably damaging 1.00
R3120:Sybu UTSW 15 44672959 missense possibly damaging 0.88
R3429:Sybu UTSW 15 44746458 missense probably damaging 0.98
R3508:Sybu UTSW 15 44673082 missense probably damaging 1.00
R3720:Sybu UTSW 15 44672632 missense possibly damaging 0.89
R4080:Sybu UTSW 15 44718943 missense probably damaging 1.00
R4898:Sybu UTSW 15 44675499 missense probably benign 0.02
R4975:Sybu UTSW 15 44677667 missense probably damaging 1.00
R5066:Sybu UTSW 15 44677644 missense probably damaging 1.00
R5783:Sybu UTSW 15 44746414 missense probably damaging 0.96
R5913:Sybu UTSW 15 44787621 missense probably damaging 1.00
R6977:Sybu UTSW 15 44677695 missense probably benign 0.00
R7044:Sybu UTSW 15 44677695 missense possibly damaging 0.79
R7139:Sybu UTSW 15 44677714 missense possibly damaging 0.93
R7328:Sybu UTSW 15 44787794 missense not run
R7543:Sybu UTSW 15 44683452 critical splice acceptor site probably null
R7851:Sybu UTSW 15 44746456 nonsense probably null
R7909:Sybu UTSW 15 44673037 nonsense probably null
R8823:Sybu UTSW 15 44677602 missense possibly damaging 0.91
Z1177:Sybu UTSW 15 44673062 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCATCTCCATGCTTTGAAG -3'
(R):5'- AGTTCCCTGGCTAATACTTGC -3'

Sequencing Primer
(F):5'- GAAGCAGAGACTCCAGTTTCTTG -3'
(R):5'- GTTCCCTGGCTAATACTTGCCAAAAC -3'
Posted On 2022-04-18