Incidental Mutation 'R9327:Ephb4'
ID 706568
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, Myk1, Tyro11
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9327 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 137350109-137378669 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137363267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 520 (S520P)
Ref Sequence ENSEMBL: ENSMUSP00000106684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably damaging
Transcript: ENSMUST00000061244
AA Change: S511P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: S511P

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111054
AA Change: S511P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: S511P

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111055
AA Change: S520P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: S520P

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144296
AA Change: S511P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: S511P

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166239
AA Change: S511P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: S511P

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Meta Mutation Damage Score 0.5695 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik G T 8: 84,010,451 Q105K unknown Het
3110043O21Rik A G 4: 35,205,883 I247T Het
A1cf T A 19: 31,918,099 M194K probably benign Het
Abcg1 T C 17: 31,114,148 S622P probably benign Het
Ahnak2 A T 12: 112,784,826 V467E Het
Amdhd2 T C 17: 24,158,447 E164G probably benign Het
Ank3 G A 10: 69,976,256 probably null Het
Bank1 A T 3: 136,093,547 N545K probably benign Het
BC067074 C A 13: 113,317,176 Q58K Het
Cep63 T C 9: 102,590,524 I548V probably benign Het
Col28a1 T C 6: 8,175,653 D65G unknown Het
Cyp2c50 A G 19: 40,090,566 N118D probably benign Het
Dock10 C T 1: 80,532,467 C1549Y probably damaging Het
Epg5 A G 18: 77,948,220 E44G probably benign Het
Eppk1 T C 15: 76,109,555 E1042G probably benign Het
Fmod A T 1: 134,040,851 N210Y probably damaging Het
Fpr3 A G 17: 17,971,451 D328G probably damaging Het
Garem2 T G 5: 30,116,991 C783G probably benign Het
Gm10542 A G 18: 44,204,622 N56D probably damaging Het
Gm20939 T A 17: 94,876,996 N357K probably benign Het
Hr A G 14: 70,567,788 H990R possibly damaging Het
Il21r A G 7: 125,626,991 N53S unknown Het
Insrr C T 3: 87,814,297 T1170I probably damaging Het
Itga11 A G 9: 62,730,752 M103V probably damaging Het
Izumo3 G T 4: 92,146,813 Q56K probably damaging Het
Kcnh8 T C 17: 52,839,056 V324A probably damaging Het
Kcnj2 T A 11: 111,072,893 N370K probably benign Het
Klf16 G T 10: 80,576,854 S116* probably null Het
Mettl16 T C 11: 74,805,263 V310A probably benign Het
Mettl7b A G 10: 128,958,738 M239T probably benign Het
Mmrn2 G A 14: 34,375,516 probably benign Het
Mtcl1 A G 17: 66,338,135 L1888P probably damaging Het
Muc5ac A C 7: 141,811,692 T1984P possibly damaging Het
Myo16 G T 8: 10,439,705 probably null Het
Nckipsd T C 9: 108,814,500 I466T possibly damaging Het
Nos1 G C 5: 117,879,337 R255P probably benign Het
Npffr2 A G 5: 89,582,802 H197R probably benign Het
Nrap T A 19: 56,351,668 M842L probably benign Het
Nxpe4 G A 9: 48,398,684 A416T probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr473 T A 7: 107,933,812 C97* probably null Het
Olfr574 T C 7: 102,948,480 V5A probably benign Het
Olfr659 A G 7: 104,671,535 I278V probably damaging Het
Ppp1r15a C T 7: 45,524,611 A258T possibly damaging Het
Prss36 A T 7: 127,933,398 Y760* probably null Het
Psg26 T A 7: 18,482,555 T120S probably damaging Het
Ptk7 A T 17: 46,568,051 L908Q probably benign Het
S100a13 G T 3: 90,515,863 D54Y unknown Het
Slc25a44 A T 3: 88,420,718 H155Q probably benign Het
Smarcc2 A G 10: 128,485,617 T894A probably damaging Het
Tle4 A G 19: 14,596,785 F39L probably damaging Het
Tmem181a G A 17: 6,295,773 V181M possibly damaging Het
Trpm3 T C 19: 22,918,640 V947A possibly damaging Het
Txndc16 G A 14: 45,141,991 T663I probably benign Het
Vmn2r45 T C 7: 8,471,533 Y832C probably damaging Het
Vmn2r9 T C 5: 108,848,975 T143A probably damaging Het
Vps26b T C 9: 27,019,454 N82D probably benign Het
Zfp318 T G 17: 46,410,966 F1298L probably damaging Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0599:Ephb4 UTSW 5 137369855 missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137360416 missense probably benign 0.00
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137366587 missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137361274 missense probably benign 0.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137357855 missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137370805 missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137354562 missense possibly damaging 0.79
R9513:Ephb4 UTSW 5 137363302 missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGTTCCAGCATCCCAAAGAG -3'
(R):5'- GGCCAGGGCTTATCATTGAAG -3'

Sequencing Primer
(F):5'- GCTGCAAGGATAAATGATGCTATAC -3'
(R):5'- TTATCATTGAAGGATAAGAACAAGGC -3'
Posted On 2022-04-18