Mutagenetix > Incidental Mutation

Incidental Mutation 'R0740:Trappc11'

70657

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

038921-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0740 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47943163-47986505 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47977623 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 224 (V224D)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061]

AlphaFold

B2RXC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039061
AA Change: V224D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: V224D

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131551

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.2%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aoc3	G	T	11: 101,223,158 (GRCm39)	V465L	probably benign	Het
C2cd5	T	A	6: 142,981,989 (GRCm39)	N625I	probably damaging	Het
Ccdc60	T	A	5: 116,328,135 (GRCm39)	R110W	probably damaging	Het
Cfap43	A	G	19: 47,824,243 (GRCm39)	F43L	possibly damaging	Het
Crabp2	A	G	3: 87,859,443 (GRCm39)	K31R	probably benign	Het
Get1	G	C	16: 95,946,798 (GRCm39)		probably benign	Het
Mib2	C	T	4: 155,743,917 (GRCm39)	G42S	probably damaging	Het
Nlrp3	T	C	11: 59,439,082 (GRCm39)	F220L	probably benign	Het
Pik3c2g	T	C	6: 139,610,791 (GRCm39)		probably null	Het
Rragc	A	G	4: 123,818,556 (GRCm39)	K257R	probably damaging	Het
Scml4	T	C	10: 42,806,559 (GRCm39)	F149S	probably damaging	Het
Tdrd1	A	G	19: 56,827,531 (GRCm39)	K178R	probably damaging	Het
Zfp964	G	T	8: 70,115,828 (GRCm39)	D143Y	probably damaging	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47,956,337 (GRCm39)	unclassified	probably benign
IGL01300:Trappc11	APN	8	47,954,903 (GRCm39)	missense	probably benign
IGL01312:Trappc11	APN	8	47,958,712 (GRCm39)	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47,972,739 (GRCm39)	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47,954,904 (GRCm39)	splice site	probably null
IGL01747:Trappc11	APN	8	47,972,656 (GRCm39)	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47,967,163 (GRCm39)	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47,957,029 (GRCm39)	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47,981,036 (GRCm39)	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47,958,766 (GRCm39)	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47,983,685 (GRCm39)	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47,960,617 (GRCm39)	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47,946,448 (GRCm39)	splice site	probably benign
IGL03030:Trappc11	APN	8	47,966,964 (GRCm39)	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47,963,912 (GRCm39)	missense	possibly damaging	0.95
bantu	UTSW	8	47,951,701 (GRCm39)	missense	probably benign	0.44
bunyoro	UTSW	8	47,965,320 (GRCm39)	splice site	probably null
nyoro	UTSW	8	47,980,014 (GRCm39)	missense	possibly damaging	0.73
serval	UTSW	8	47,957,000 (GRCm39)	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47,956,355 (GRCm39)	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47,956,355 (GRCm39)	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47,958,610 (GRCm39)	splice site	probably benign
R0180:Trappc11	UTSW	8	47,981,009 (GRCm39)	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47,980,014 (GRCm39)	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47,956,447 (GRCm39)	missense	probably benign	0.01
R1352:Trappc11	UTSW	8	47,978,081 (GRCm39)	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47,957,000 (GRCm39)	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47,957,000 (GRCm39)	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47,983,862 (GRCm39)	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47,954,715 (GRCm39)	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47,982,362 (GRCm39)	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47,958,771 (GRCm39)	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47,956,451 (GRCm39)	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47,956,977 (GRCm39)	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47,951,708 (GRCm39)	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47,958,351 (GRCm39)	intron	probably benign
R3739:Trappc11	UTSW	8	47,967,138 (GRCm39)	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47,978,003 (GRCm39)	splice site	probably benign
R4581:Trappc11	UTSW	8	47,946,380 (GRCm39)	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47,966,801 (GRCm39)	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47,972,700 (GRCm39)	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47,943,930 (GRCm39)	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47,975,476 (GRCm39)	nonsense	probably null
R5091:Trappc11	UTSW	8	47,965,639 (GRCm39)	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47,966,437 (GRCm39)	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47,963,998 (GRCm39)	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47,958,339 (GRCm39)	intron	probably benign
R5293:Trappc11	UTSW	8	47,946,377 (GRCm39)	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47,983,766 (GRCm39)	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47,965,642 (GRCm39)	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47,965,594 (GRCm39)	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47,972,613 (GRCm39)	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47,949,952 (GRCm39)	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47,954,593 (GRCm39)	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47,982,529 (GRCm39)	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47,983,808 (GRCm39)	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47,965,320 (GRCm39)	splice site	probably null
R7541:Trappc11	UTSW	8	47,958,617 (GRCm39)	splice site	probably null
R7544:Trappc11	UTSW	8	47,975,449 (GRCm39)	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47,975,411 (GRCm39)	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47,979,979 (GRCm39)	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47,982,391 (GRCm39)	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47,969,624 (GRCm39)	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47,954,883 (GRCm39)	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47,951,701 (GRCm39)	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47,982,439 (GRCm39)	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47,972,713 (GRCm39)	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47,946,348 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTTAAGATCAAGACGACTGAGATAGGCG -3'
(R):5'- ACAGTGTGGGTCAACAGTGCG -3'

Sequencing Primer
(F):5'- GCTGTCTGTACAGGATCACTAACA -3'
(R):5'- caaaacaaaacaaaacaaacaacaac -3'

Posted On

2013-09-30