Incidental Mutation 'R9327:Nckipsd'
ID 706584
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms ORF1, DIP1, Wasbp, SPIN90, AF3P21, WISH
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.438) question?
Stock # R9327 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108685567-108696043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108691699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 466 (I466T)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000035218
AA Change: I466T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: I466T

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,895,499 (GRCm39) M194K probably benign Het
Abcg1 T C 17: 31,333,122 (GRCm39) S622P probably benign Het
Ahnak2 A T 12: 112,748,446 (GRCm39) V467E Het
Amdhd2 T C 17: 24,377,421 (GRCm39) E164G probably benign Het
Ank3 G A 10: 69,812,086 (GRCm39) probably null Het
Bank1 A T 3: 135,799,308 (GRCm39) N545K probably benign Het
C9orf72 A G 4: 35,205,883 (GRCm39) I247T Het
Cep63 T C 9: 102,467,723 (GRCm39) I548V probably benign Het
Col28a1 T C 6: 8,175,653 (GRCm39) D65G unknown Het
Cspg4b C A 13: 113,453,710 (GRCm39) Q58K Het
Cyp2c50 A G 19: 40,079,010 (GRCm39) N118D probably benign Het
Dock10 C T 1: 80,510,184 (GRCm39) C1549Y probably damaging Het
Epg5 A G 18: 77,991,435 (GRCm39) E44G probably benign Het
Ephb4 T C 5: 137,361,529 (GRCm39) S520P probably damaging Het
Eppk1 T C 15: 75,993,755 (GRCm39) E1042G probably benign Het
Fmod A T 1: 133,968,589 (GRCm39) N210Y probably damaging Het
Fpr3 A G 17: 18,191,713 (GRCm39) D328G probably damaging Het
Garem2 T G 5: 30,321,989 (GRCm39) C783G probably benign Het
Gm10542 A G 18: 44,337,689 (GRCm39) N56D probably damaging Het
Gm20939 T A 17: 95,184,424 (GRCm39) N357K probably benign Het
Hr A G 14: 70,805,228 (GRCm39) H990R possibly damaging Het
Il21r A G 7: 125,226,163 (GRCm39) N53S unknown Het
Insrr C T 3: 87,721,604 (GRCm39) T1170I probably damaging Het
Itga11 A G 9: 62,638,034 (GRCm39) M103V probably damaging Het
Izumo3 G T 4: 92,035,050 (GRCm39) Q56K probably damaging Het
Kcnh8 T C 17: 53,146,084 (GRCm39) V324A probably damaging Het
Kcnj2 T A 11: 110,963,719 (GRCm39) N370K probably benign Het
Klf16 G T 10: 80,412,688 (GRCm39) S116* probably null Het
Mettl16 T C 11: 74,696,089 (GRCm39) V310A probably benign Het
Misp3 G T 8: 84,737,080 (GRCm39) Q105K unknown Het
Mmrn2 G A 14: 34,097,473 (GRCm39) probably benign Het
Mtcl1 A G 17: 66,645,130 (GRCm39) L1888P probably damaging Het
Muc5ac A C 7: 141,365,429 (GRCm39) T1984P possibly damaging Het
Myo16 G T 8: 10,489,705 (GRCm39) probably null Het
Nos1 G C 5: 118,017,402 (GRCm39) R255P probably benign Het
Npffr2 A G 5: 89,730,661 (GRCm39) H197R probably benign Het
Nrap T A 19: 56,340,100 (GRCm39) M842L probably benign Het
Nxpe4 G A 9: 48,309,984 (GRCm39) A416T probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or51t4 T C 7: 102,597,687 (GRCm39) V5A probably benign Het
Or52n20 A G 7: 104,320,742 (GRCm39) I278V probably damaging Het
Or5p53 T A 7: 107,533,019 (GRCm39) C97* probably null Het
Ppp1r15a C T 7: 45,174,035 (GRCm39) A258T possibly damaging Het
Prss36 A T 7: 127,532,570 (GRCm39) Y760* probably null Het
Psg26 T A 7: 18,216,480 (GRCm39) T120S probably damaging Het
Ptk7 A T 17: 46,878,977 (GRCm39) L908Q probably benign Het
S100a13 G T 3: 90,423,170 (GRCm39) D54Y unknown Het
Slc25a44 A T 3: 88,328,025 (GRCm39) H155Q probably benign Het
Smarcc2 A G 10: 128,321,486 (GRCm39) T894A probably damaging Het
Tle4 A G 19: 14,574,149 (GRCm39) F39L probably damaging Het
Tmem181a G A 17: 6,346,048 (GRCm39) V181M possibly damaging Het
Tmt1b A G 10: 128,794,607 (GRCm39) M239T probably benign Het
Trpm3 T C 19: 22,896,004 (GRCm39) V947A possibly damaging Het
Txndc16 G A 14: 45,379,448 (GRCm39) T663I probably benign Het
Vmn2r45 T C 7: 8,474,532 (GRCm39) Y832C probably damaging Het
Vmn2r9 T C 5: 108,996,841 (GRCm39) T143A probably damaging Het
Vps26b T C 9: 26,930,750 (GRCm39) N82D probably benign Het
Zfp318 T G 17: 46,721,892 (GRCm39) F1298L probably damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108,692,168 (GRCm39) missense probably benign 0.07
IGL01601:Nckipsd APN 9 108,691,154 (GRCm39) missense probably benign 0.00
IGL01809:Nckipsd APN 9 108,694,753 (GRCm39) missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108,688,813 (GRCm39) missense probably benign
R0714:Nckipsd UTSW 9 108,691,333 (GRCm39) unclassified probably benign
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108,689,571 (GRCm39) missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108,691,863 (GRCm39) splice site probably null
R2127:Nckipsd UTSW 9 108,688,932 (GRCm39) missense probably benign
R3697:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108,691,275 (GRCm39) missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108,691,938 (GRCm39) missense probably benign 0.28
R4879:Nckipsd UTSW 9 108,691,114 (GRCm39) unclassified probably benign
R5796:Nckipsd UTSW 9 108,688,813 (GRCm39) missense probably benign
R5891:Nckipsd UTSW 9 108,685,808 (GRCm39) missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108,689,435 (GRCm39) missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108,691,176 (GRCm39) missense probably benign 0.00
R6144:Nckipsd UTSW 9 108,689,585 (GRCm39) missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108,688,882 (GRCm39) missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108,691,280 (GRCm39) missense probably benign 0.30
R7676:Nckipsd UTSW 9 108,692,153 (GRCm39) missense probably damaging 1.00
R7702:Nckipsd UTSW 9 108,691,216 (GRCm39) nonsense probably null
R7893:Nckipsd UTSW 9 108,692,588 (GRCm39) missense probably damaging 1.00
R8257:Nckipsd UTSW 9 108,692,127 (GRCm39) missense probably benign 0.10
R9353:Nckipsd UTSW 9 108,691,471 (GRCm39) missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108,689,837 (GRCm39) missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108,694,744 (GRCm39) missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108,691,876 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCGAAGTTTGCAAGAAAATGTG -3'
(R):5'- GGGCAGAGTAACAGAGCTTC -3'

Sequencing Primer
(F):5'- CAAAAGGAGTGATTTTGAGTCTGTCC -3'
(R):5'- AGAGCTTCTGGTGGTCTGG -3'
Posted On 2022-04-18