Incidental Mutation 'R9328:Brinp3'
ID 706616
Institutional Source Beutler Lab
Gene Symbol Brinp3
Ensembl Gene ENSMUSG00000035131
Gene Name bone morphogenetic protein/retinoic acid inducible neural specific 3
Synonyms Fam5c, B830045N13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock # R9328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 146494760-146902472 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 146831717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 373 (V373E)
Ref Sequence ENSEMBL: ENSMUSP00000074201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]
AlphaFold Q499E0
Predicted Effect probably damaging
Transcript: ENSMUST00000074622
AA Change: V373E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: V373E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128345
SMART Domains Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166814
AA Change: V373E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: V373E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 38,194,848 T102A probably benign Het
1700109H08Rik A G 5: 3,582,161 K164E possibly damaging Het
2410089E03Rik A G 15: 8,186,208 D416G probably damaging Het
2610042L04Rik C T 14: 4,350,013 Q74* probably null Het
Adgrb2 T A 4: 130,021,570 M1381K probably damaging Het
Adgrv1 C A 13: 81,472,404 D3975Y probably damaging Het
Ano10 C T 9: 122,261,102 E382K possibly damaging Het
Ascc3 T C 10: 50,658,919 V636A probably damaging Het
AU040320 T C 4: 126,835,539 V498A possibly damaging Het
Bahcc1 C T 11: 120,275,059 T1047I possibly damaging Het
BC004004 A T 17: 29,282,708 T74S possibly damaging Het
Bend3 A G 10: 43,511,423 D604G possibly damaging Het
Bsph2 A T 7: 13,556,839 D38E probably benign Het
Catsperd A G 17: 56,658,074 I474V possibly damaging Het
Ccdc180 A G 4: 45,902,447 N292S possibly damaging Het
Cd1d1 A T 3: 86,998,152 V178E possibly damaging Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Champ1 A G 8: 13,879,392 K517E probably damaging Het
Chrna9 T C 5: 65,971,226 F259S probably damaging Het
Chuk A T 19: 44,096,983 C241* probably null Het
Clns1a A G 7: 97,714,033 Y204C probably benign Het
Cyp2j7 A T 4: 96,227,632 N192K probably damaging Het
Ddr2 A G 1: 170,001,935 V250A probably benign Het
Dlgap2 A G 8: 14,727,441 S229G probably damaging Het
Dmrt1 A T 19: 25,545,867 H194L probably damaging Het
Dock7 A T 4: 99,079,827 F138I Het
Dsg2 T C 18: 20,582,790 V263A possibly damaging Het
Dusp16 A G 6: 134,739,939 L135P probably damaging Het
Dysf A G 6: 84,073,913 N414S probably damaging Het
Efhc1 A G 1: 20,960,374 Y177C probably damaging Het
Fam83e A T 7: 45,723,488 R174S probably benign Het
Fgf4 C T 7: 144,862,927 L199F probably damaging Het
Fignl2 A G 15: 101,053,390 L337P unknown Het
Gatsl3 T C 11: 4,220,423 F140L probably benign Het
Gm15448 T A 7: 3,824,581 R192S unknown Het
Gm4353 T C 7: 116,083,489 R286G probably damaging Het
Gm436 T A 4: 144,674,686 H76L probably benign Het
Gm5142 T C 14: 59,178,677 S11G probably benign Het
Gpr151 A G 18: 42,579,205 V136A probably damaging Het
Ift80 T A 3: 68,940,150 I338F probably damaging Het
Itgb4 A G 11: 115,989,799 S693G probably benign Het
Kif13a T A 13: 46,798,362 I812F probably damaging Het
Krit1 T C 5: 3,812,577 probably null Het
Mapk6 T C 9: 75,397,970 D55G possibly damaging Het
Matn3 A G 12: 8,952,033 I82V possibly damaging Het
Mecom T A 3: 30,009,845 D32V unknown Het
Nacad T C 11: 6,602,417 H258R possibly damaging Het
Ndufaf5 T A 2: 140,188,832 S213T possibly damaging Het
Nphp1 C T 2: 127,740,972 D674N possibly damaging Het
Nsmaf A G 4: 6,426,412 L250P probably damaging Het
Ogdh T C 11: 6,347,838 S571P probably benign Het
Olfr391-ps T C 11: 73,799,652 Y35C probably damaging Het
Olfr641 T A 7: 104,040,061 D88E Het
Olfr944 T C 9: 39,217,879 I174T probably damaging Het
Osbpl11 A G 16: 33,226,875 I403V probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plat A G 8: 22,778,117 R300G probably damaging Het
Ppid T C 3: 79,597,752 I134T probably damaging Het
Rad51ap2 A G 12: 11,457,771 I565V probably benign Het
Rasa1 T C 13: 85,255,456 probably null Het
Sema4a C T 3: 88,438,306 W490* probably null Het
Sept3 A G 15: 82,289,238 Y257C probably damaging Het
Sh3rf2 C A 18: 42,141,096 F442L probably benign Het
Sipa1l1 A G 12: 82,342,018 I339M possibly damaging Het
Six2 T C 17: 85,687,768 N62S possibly damaging Het
Slc44a5 T C 3: 154,259,041 I526T probably benign Het
Smarca5 T C 8: 80,720,749 S402G probably benign Het
Son T A 16: 91,655,757 V464E possibly damaging Het
Sorcs3 A G 19: 48,797,511 K1144E probably damaging Het
Stxbp6 A G 12: 44,855,876 L204P probably damaging Het
Tchh A G 3: 93,444,263 R337G unknown Het
Tgm4 T C 9: 123,056,632 V413A possibly damaging Het
Tmem131 G A 1: 36,819,155 Q704* probably null Het
Tmpo T C 10: 91,162,963 K321E probably damaging Het
Trim75 G T 8: 64,982,663 N378K probably benign Het
Tspan18 T A 2: 93,205,720 I227F probably benign Het
Ttn C T 2: 76,711,182 W33820* probably null Het
Urb2 T A 8: 124,047,295 Y1522N probably damaging Het
Zbtb40 T C 4: 137,018,309 N138D probably benign Het
Zfp715 A T 7: 43,297,904 H877Q possibly damaging Het
Other mutations in Brinp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Brinp3 APN 1 146901774 missense probably damaging 0.99
IGL00503:Brinp3 APN 1 146901167 missense probably benign
IGL01702:Brinp3 APN 1 146751997 splice site probably benign
IGL01728:Brinp3 APN 1 146831551 splice site probably null
IGL01733:Brinp3 APN 1 146514803 missense probably benign 0.33
IGL01937:Brinp3 APN 1 146901140 missense probably benign
IGL02020:Brinp3 APN 1 146902127 utr 3 prime probably benign
IGL02082:Brinp3 APN 1 146751862 missense probably damaging 1.00
IGL02365:Brinp3 APN 1 146901122 missense probably benign 0.00
IGL02366:Brinp3 APN 1 146701743 missense possibly damaging 0.84
IGL02565:Brinp3 APN 1 146902032 missense probably damaging 0.98
IGL02999:Brinp3 APN 1 146701849 splice site probably null
IGL03099:Brinp3 APN 1 146902097 missense possibly damaging 0.91
PIT4283001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
PIT4418001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0266:Brinp3 UTSW 1 146682680 nonsense probably null
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1522:Brinp3 UTSW 1 146901890 missense probably damaging 0.99
R1596:Brinp3 UTSW 1 146514782 missense probably benign
R1898:Brinp3 UTSW 1 146901249 missense possibly damaging 0.93
R2036:Brinp3 UTSW 1 146701841 missense possibly damaging 0.84
R2224:Brinp3 UTSW 1 146901920 nonsense probably null
R2272:Brinp3 UTSW 1 146901404 missense possibly damaging 0.93
R2291:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R2322:Brinp3 UTSW 1 146701754 missense probably benign
R2880:Brinp3 UTSW 1 146902002 missense probably damaging 0.98
R3918:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3939:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3940:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3941:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3942:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R4095:Brinp3 UTSW 1 146901692 missense possibly damaging 0.72
R4783:Brinp3 UTSW 1 146727640 intron probably benign
R5009:Brinp3 UTSW 1 146901049 missense probably benign 0.25
R5034:Brinp3 UTSW 1 146727720 intron probably benign
R5166:Brinp3 UTSW 1 146901367 missense probably damaging 0.96
R5372:Brinp3 UTSW 1 146831726 missense probably damaging 1.00
R5472:Brinp3 UTSW 1 146901459 missense possibly damaging 0.86
R5651:Brinp3 UTSW 1 146701799 missense probably benign 0.01
R5681:Brinp3 UTSW 1 146901746 missense probably benign 0.12
R6351:Brinp3 UTSW 1 146901585 missense probably damaging 0.96
R6470:Brinp3 UTSW 1 146901906 missense probably damaging 0.99
R6499:Brinp3 UTSW 1 146901693 missense possibly damaging 0.86
R7078:Brinp3 UTSW 1 146514889 nonsense probably null
R7223:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R7322:Brinp3 UTSW 1 146682688 nonsense probably null
R7347:Brinp3 UTSW 1 146902086 missense probably benign 0.22
R7375:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7412:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7532:Brinp3 UTSW 1 146901401 missense probably damaging 0.98
R7562:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7576:Brinp3 UTSW 1 146901563 missense probably damaging 0.99
R7723:Brinp3 UTSW 1 146701671 missense probably damaging 1.00
R7737:Brinp3 UTSW 1 146682594 missense probably damaging 0.98
R7793:Brinp3 UTSW 1 146746568 missense probably benign 0.20
R8334:Brinp3 UTSW 1 146902053 missense probably damaging 0.99
R8401:Brinp3 UTSW 1 146901446 missense probably benign 0.17
R9205:Brinp3 UTSW 1 146902089 missense possibly damaging 0.57
X0060:Brinp3 UTSW 1 146901786 missense probably benign 0.01
Z1176:Brinp3 UTSW 1 146902076 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTGGAGGGAAAATACTTGTTTC -3'
(R):5'- TTATTCCTCTGAACACAACTCCAAG -3'

Sequencing Primer
(F):5'- CTTTATGAAAAGACTACCCATG -3'
(R):5'- ACACAACTCCAAGAGATTATTTTGAG -3'
Posted On 2022-04-18