Mutagenetix > Incidental Mutation

Incidental Mutation 'R9328:Brinp3'

706616

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R9328 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 146831717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 373 (V373E)

Ref Sequence

ENSEMBL: ENSMUSP00000074201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

probably damaging
Transcript: ENSMUST00000074622
AA Change: V373E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: V373E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166814
AA Change: V373E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: V373E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C10Rik	A	G	7: 38,194,848	T102A	probably benign	Het
1700109H08Rik	A	G	5: 3,582,161	K164E	possibly damaging	Het
2410089E03Rik	A	G	15: 8,186,208	D416G	probably damaging	Het
2610042L04Rik	C	T	14: 4,350,013	Q74*	probably null	Het
Adgrb2	T	A	4: 130,021,570	M1381K	probably damaging	Het
Adgrv1	C	A	13: 81,472,404	D3975Y	probably damaging	Het
Ano10	C	T	9: 122,261,102	E382K	possibly damaging	Het
Ascc3	T	C	10: 50,658,919	V636A	probably damaging	Het
AU040320	T	C	4: 126,835,539	V498A	possibly damaging	Het
Bahcc1	C	T	11: 120,275,059	T1047I	possibly damaging	Het
BC004004	A	T	17: 29,282,708	T74S	possibly damaging	Het
Bend3	A	G	10: 43,511,423	D604G	possibly damaging	Het
Bsph2	A	T	7: 13,556,839	D38E	probably benign	Het
Catsperd	A	G	17: 56,658,074	I474V	possibly damaging	Het
Ccdc180	A	G	4: 45,902,447	N292S	possibly damaging	Het
Cd1d1	A	T	3: 86,998,152	V178E	possibly damaging	Het
Cdca2	T	A	14: 67,693,682	R521W	probably damaging	Het
Champ1	A	G	8: 13,879,392	K517E	probably damaging	Het
Chrna9	T	C	5: 65,971,226	F259S	probably damaging	Het
Chuk	A	T	19: 44,096,983	C241*	probably null	Het
Clns1a	A	G	7: 97,714,033	Y204C	probably benign	Het
Cyp2j7	A	T	4: 96,227,632	N192K	probably damaging	Het
Ddr2	A	G	1: 170,001,935	V250A	probably benign	Het
Dlgap2	A	G	8: 14,727,441	S229G	probably damaging	Het
Dmrt1	A	T	19: 25,545,867	H194L	probably damaging	Het
Dock7	A	T	4: 99,079,827	F138I		Het
Dsg2	T	C	18: 20,582,790	V263A	possibly damaging	Het
Dusp16	A	G	6: 134,739,939	L135P	probably damaging	Het
Dysf	A	G	6: 84,073,913	N414S	probably damaging	Het
Efhc1	A	G	1: 20,960,374	Y177C	probably damaging	Het
Fam83e	A	T	7: 45,723,488	R174S	probably benign	Het
Fgf4	C	T	7: 144,862,927	L199F	probably damaging	Het
Fignl2	A	G	15: 101,053,390	L337P	unknown	Het
Gatsl3	T	C	11: 4,220,423	F140L	probably benign	Het
Gm15448	T	A	7: 3,824,581	R192S	unknown	Het
Gm4353	T	C	7: 116,083,489	R286G	probably damaging	Het
Gm436	T	A	4: 144,674,686	H76L	probably benign	Het
Gm5142	T	C	14: 59,178,677	S11G	probably benign	Het
Gpr151	A	G	18: 42,579,205	V136A	probably damaging	Het
Ift80	T	A	3: 68,940,150	I338F	probably damaging	Het
Itgb4	A	G	11: 115,989,799	S693G	probably benign	Het
Kif13a	T	A	13: 46,798,362	I812F	probably damaging	Het
Krit1	T	C	5: 3,812,577		probably null	Het
Mapk6	T	C	9: 75,397,970	D55G	possibly damaging	Het
Matn3	A	G	12: 8,952,033	I82V	possibly damaging	Het
Mecom	T	A	3: 30,009,845	D32V	unknown	Het
Nacad	T	C	11: 6,602,417	H258R	possibly damaging	Het
Ndufaf5	T	A	2: 140,188,832	S213T	possibly damaging	Het
Nphp1	C	T	2: 127,740,972	D674N	possibly damaging	Het
Nsmaf	A	G	4: 6,426,412	L250P	probably damaging	Het
Ogdh	T	C	11: 6,347,838	S571P	probably benign	Het
Olfr391-ps	T	C	11: 73,799,652	Y35C	probably damaging	Het
Olfr641	T	A	7: 104,040,061	D88E		Het
Olfr944	T	C	9: 39,217,879	I174T	probably damaging	Het
Osbpl11	A	G	16: 33,226,875	I403V	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Plat	A	G	8: 22,778,117	R300G	probably damaging	Het
Ppid	T	C	3: 79,597,752	I134T	probably damaging	Het
Rad51ap2	A	G	12: 11,457,771	I565V	probably benign	Het
Rasa1	T	C	13: 85,255,456		probably null	Het
Sema4a	C	T	3: 88,438,306	W490*	probably null	Het
Sept3	A	G	15: 82,289,238	Y257C	probably damaging	Het
Sh3rf2	C	A	18: 42,141,096	F442L	probably benign	Het
Sipa1l1	A	G	12: 82,342,018	I339M	possibly damaging	Het
Six2	T	C	17: 85,687,768	N62S	possibly damaging	Het
Slc44a5	T	C	3: 154,259,041	I526T	probably benign	Het
Smarca5	T	C	8: 80,720,749	S402G	probably benign	Het
Son	T	A	16: 91,655,757	V464E	possibly damaging	Het
Sorcs3	A	G	19: 48,797,511	K1144E	probably damaging	Het
Stxbp6	A	G	12: 44,855,876	L204P	probably damaging	Het
Tchh	A	G	3: 93,444,263	R337G	unknown	Het
Tgm4	T	C	9: 123,056,632	V413A	possibly damaging	Het
Tmem131	G	A	1: 36,819,155	Q704*	probably null	Het
Tmpo	T	C	10: 91,162,963	K321E	probably damaging	Het
Trim75	G	T	8: 64,982,663	N378K	probably benign	Het
Tspan18	T	A	2: 93,205,720	I227F	probably benign	Het
Ttn	C	T	2: 76,711,182	W33820*	probably null	Het
Urb2	T	A	8: 124,047,295	Y1522N	probably damaging	Het
Zbtb40	T	C	4: 137,018,309	N138D	probably benign	Het
Zfp715	A	T	7: 43,297,904	H877Q	possibly damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTTGGAGGGAAAATACTTGTTTC -3'
(R):5'- TTATTCCTCTGAACACAACTCCAAG -3'

Sequencing Primer
(F):5'- CTTTATGAAAAGACTACCCATG -3'
(R):5'- ACACAACTCCAAGAGATTATTTTGAG -3'

Posted On

2022-04-18