Incidental Mutation 'R0740:Aoc3'
ID70662
Institutional Source Beutler Lab
Gene Symbol Aoc3
Ensembl Gene ENSMUSG00000019326
Gene Nameamine oxidase, copper containing 3
Synonymssemicarbazide-sensitive amine oxidase, SSAO, VAP1
MMRRC Submission 038921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0740 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101330605-101341938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101332332 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 465 (V465L)
Ref Sequence ENSEMBL: ENSMUSP00000099394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000041095] [ENSMUST00000103105] [ENSMUST00000107264]
Predicted Effect probably benign
Transcript: ENSMUST00000017316
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041095
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103105
AA Change: V465L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326
AA Change: V465L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107264
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice display decreased lymphocyte migration and homing in response to inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C2cd5 T A 6: 143,036,263 N625I probably damaging Het
Ccdc60 T A 5: 116,190,076 R110W probably damaging Het
Cfap43 A G 19: 47,835,804 F43L possibly damaging Het
Crabp2 A G 3: 87,952,136 K31R probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nlrp3 T C 11: 59,548,256 F220L probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Rragc A G 4: 123,924,763 K257R probably damaging Het
Scml4 T C 10: 42,930,563 F149S probably damaging Het
Tdrd1 A G 19: 56,839,099 K178R probably damaging Het
Trappc11 A T 8: 47,524,588 V224D probably damaging Het
Wrb G C 16: 96,145,598 probably benign Het
Zfp964 G T 8: 69,663,178 D143Y probably damaging Het
Other mutations in Aoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Aoc3 APN 11 101337478 missense possibly damaging 0.73
IGL02026:Aoc3 APN 11 101337595 missense probably benign
IGL02500:Aoc3 APN 11 101337389 nonsense probably null
R0463:Aoc3 UTSW 11 101331606 missense probably damaging 1.00
R0524:Aoc3 UTSW 11 101337511 missense probably damaging 1.00
R0538:Aoc3 UTSW 11 101332138 missense possibly damaging 0.77
R0685:Aoc3 UTSW 11 101336447 missense possibly damaging 0.84
R0946:Aoc3 UTSW 11 101332305 missense possibly damaging 0.89
R1723:Aoc3 UTSW 11 101336435 missense possibly damaging 0.82
R1869:Aoc3 UTSW 11 101331467 nonsense probably null
R3735:Aoc3 UTSW 11 101332219 missense probably damaging 0.99
R4497:Aoc3 UTSW 11 101332045 missense possibly damaging 0.70
R4613:Aoc3 UTSW 11 101337659 intron probably benign
R4858:Aoc3 UTSW 11 101331662 missense probably damaging 1.00
R4954:Aoc3 UTSW 11 101332099 missense probably damaging 1.00
R4976:Aoc3 UTSW 11 101330974 missense probably damaging 1.00
R5770:Aoc3 UTSW 11 101331752 nonsense probably null
R6679:Aoc3 UTSW 11 101331453 missense probably damaging 1.00
R7485:Aoc3 UTSW 11 101337403 missense probably damaging 1.00
R7693:Aoc3 UTSW 11 101332512 missense probably benign 0.00
R7888:Aoc3 UTSW 11 101332497 missense probably damaging 1.00
R8041:Aoc3 UTSW 11 101332306 missense probably benign 0.00
R8444:Aoc3 UTSW 11 101341747 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGCATTGGCAAATACTCTACCCC -3'
(R):5'- CAATGATGTCTCACCTGCCACATCC -3'

Sequencing Primer
(F):5'- GGGTAGACTGTCCTTACCTCG -3'
(R):5'- GCCACATCCAGATCCACTTTG -3'
Posted On2013-09-30