Mutagenetix > Incidental Mutation

Incidental Mutation 'R0740:Cfap43'

70663

Institutional Source

Beutler Lab

Gene Symbol

Cfap43

Ensembl Gene

ENSMUSG00000044948

Gene Name

cilia and flagella associated protein 43

Synonyms

D19Ertd652e, 4632415N18Rik, Wdr96, 4930428C11Rik, 4930463G05Rik

MMRRC Submission

038921-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R0740 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47723706-47825893 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47824243 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 43 (F43L)

Ref Sequence

ENSEMBL: ENSMUSP00000125007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160247]

AlphaFold

E9Q7R9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000026048

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159204

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160247
AA Change: F43L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948
AA Change: F43L

Domain	Start	End	E-Value	Type
low complexity region	12	36	N/A	INTRINSIC
Blast:WD40	70	111	6e-7	BLAST
Blast:WD40	115	156	1e-5	BLAST
Blast:WD40	162	197	8e-10	BLAST
WD40	349	388	1.07e0	SMART
Blast:WD40	392	432	3e-13	BLAST
WD40	435	473	3.96e1	SMART
WD40	479	518	3.82e1	SMART
Blast:WD40	638	683	8e-17	BLAST
Blast:WD40	689	728	1e-17	BLAST
low complexity region	766	781	N/A	INTRINSIC
coiled coil region	855	886	N/A	INTRINSIC
coiled coil region	925	961	N/A	INTRINSIC
low complexity region	971	981	N/A	INTRINSIC
coiled coil region	1170	1224	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
low complexity region	1268	1279	N/A	INTRINSIC
low complexity region	1524	1529	N/A	INTRINSIC
coiled coil region	1652	1671	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.2%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aoc3	G	T	11: 101,223,158 (GRCm39)	V465L	probably benign	Het
C2cd5	T	A	6: 142,981,989 (GRCm39)	N625I	probably damaging	Het
Ccdc60	T	A	5: 116,328,135 (GRCm39)	R110W	probably damaging	Het
Crabp2	A	G	3: 87,859,443 (GRCm39)	K31R	probably benign	Het
Get1	G	C	16: 95,946,798 (GRCm39)		probably benign	Het
Mib2	C	T	4: 155,743,917 (GRCm39)	G42S	probably damaging	Het
Nlrp3	T	C	11: 59,439,082 (GRCm39)	F220L	probably benign	Het
Pik3c2g	T	C	6: 139,610,791 (GRCm39)		probably null	Het
Rragc	A	G	4: 123,818,556 (GRCm39)	K257R	probably damaging	Het
Scml4	T	C	10: 42,806,559 (GRCm39)	F149S	probably damaging	Het
Tdrd1	A	G	19: 56,827,531 (GRCm39)	K178R	probably damaging	Het
Trappc11	A	T	8: 47,977,623 (GRCm39)	V224D	probably damaging	Het
Zfp964	G	T	8: 70,115,828 (GRCm39)	D143Y	probably damaging	Het

Other mutations in Cfap43

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Cfap43	APN	19	47,818,914 (GRCm39)	missense	probably benign	0.08
IGL00325:Cfap43	APN	19	47,811,627 (GRCm39)	splice site	probably benign
IGL00918:Cfap43	APN	19	47,885,100 (GRCm39)	missense	probably damaging	1.00
IGL01402:Cfap43	APN	19	47,784,105 (GRCm39)	missense	probably benign	0.25
IGL01404:Cfap43	APN	19	47,784,105 (GRCm39)	missense	probably benign	0.25
IGL01656:Cfap43	APN	19	47,740,339 (GRCm39)	missense	possibly damaging	0.95
IGL01738:Cfap43	APN	19	47,785,624 (GRCm39)	missense	probably damaging	0.97
IGL02168:Cfap43	APN	19	47,740,362 (GRCm39)	splice site	probably benign
IGL02225:Cfap43	APN	19	47,800,616 (GRCm39)	missense	probably benign	0.00
IGL02308:Cfap43	APN	19	47,736,463 (GRCm39)	missense	probably benign
IGL02354:Cfap43	APN	19	47,885,852 (GRCm39)	nonsense	probably null
IGL02361:Cfap43	APN	19	47,885,852 (GRCm39)	nonsense	probably null
IGL03283:Cfap43	APN	19	47,779,851 (GRCm39)	splice site	probably benign
3-1:Cfap43	UTSW	19	47,740,294 (GRCm39)	missense	probably benign	0.02
IGL03046:Cfap43	UTSW	19	47,804,302 (GRCm39)	missense	probably damaging	1.00
PIT4495001:Cfap43	UTSW	19	47,885,741 (GRCm39)	missense	probably damaging	1.00
R0270:Cfap43	UTSW	19	47,785,642 (GRCm39)	splice site	probably benign
R0421:Cfap43	UTSW	19	47,824,014 (GRCm39)	missense	probably benign	0.00
R0433:Cfap43	UTSW	19	47,814,210 (GRCm39)	missense	probably benign	0.44
R0576:Cfap43	UTSW	19	47,785,579 (GRCm39)	missense	probably benign	0.00
R0646:Cfap43	UTSW	19	47,752,115 (GRCm39)	missense	probably benign	0.25
R0836:Cfap43	UTSW	19	47,804,285 (GRCm39)	missense	probably benign	0.02
R0899:Cfap43	UTSW	19	47,736,433 (GRCm39)	missense	possibly damaging	0.93
R1171:Cfap43	UTSW	19	47,824,150 (GRCm39)	missense	probably benign	0.03
R1271:Cfap43	UTSW	19	47,736,387 (GRCm39)	missense	probably damaging	0.98
R1271:Cfap43	UTSW	19	47,728,183 (GRCm39)	missense	probably benign	0.22
R1371:Cfap43	UTSW	19	47,824,045 (GRCm39)	missense	possibly damaging	0.95
R1469:Cfap43	UTSW	19	47,885,314 (GRCm39)	missense	probably damaging	1.00
R1541:Cfap43	UTSW	19	47,752,291 (GRCm39)	splice site	probably null
R1625:Cfap43	UTSW	19	47,739,527 (GRCm39)	missense	probably damaging	1.00
R1679:Cfap43	UTSW	19	47,761,553 (GRCm39)	missense	probably benign	0.00
R1690:Cfap43	UTSW	19	47,739,505 (GRCm39)	critical splice donor site	probably null
R1820:Cfap43	UTSW	19	47,885,655 (GRCm39)	missense	probably damaging	0.99
R1891:Cfap43	UTSW	19	47,802,380 (GRCm39)	missense	probably damaging	0.97
R1956:Cfap43	UTSW	19	47,885,649 (GRCm39)	missense	probably benign	0.19
R1958:Cfap43	UTSW	19	47,885,649 (GRCm39)	missense	probably benign	0.19
R2110:Cfap43	UTSW	19	47,824,197 (GRCm39)	missense	probably damaging	1.00
R2118:Cfap43	UTSW	19	47,758,877 (GRCm39)	missense	probably damaging	1.00
R2290:Cfap43	UTSW	19	47,761,574 (GRCm39)	missense	probably damaging	0.99
R3691:Cfap43	UTSW	19	47,885,512 (GRCm39)	missense	probably benign	0.01
R3765:Cfap43	UTSW	19	47,824,014 (GRCm39)	missense	probably benign	0.01
R3917:Cfap43	UTSW	19	47,886,189 (GRCm39)	missense	probably benign	0.00
R3924:Cfap43	UTSW	19	47,785,555 (GRCm39)	missense	probably benign	0.00
R3925:Cfap43	UTSW	19	47,785,555 (GRCm39)	missense	probably benign	0.00
R3947:Cfap43	UTSW	19	47,754,418 (GRCm39)	missense	probably benign	0.28
R4256:Cfap43	UTSW	19	47,770,844 (GRCm39)	missense	probably benign	0.06
R4385:Cfap43	UTSW	19	47,785,568 (GRCm39)	missense	probably benign	0.28
R4395:Cfap43	UTSW	19	47,740,352 (GRCm39)	missense	probably benign	0.00
R4405:Cfap43	UTSW	19	47,728,236 (GRCm39)	missense	possibly damaging	0.57
R4541:Cfap43	UTSW	19	47,736,454 (GRCm39)	missense	probably benign	0.02
R4583:Cfap43	UTSW	19	47,825,655 (GRCm39)	missense	probably null	0.99
R4690:Cfap43	UTSW	19	47,736,298 (GRCm39)	missense	probably benign	0.45
R4852:Cfap43	UTSW	19	47,885,550 (GRCm39)	missense	possibly damaging	0.87
R5185:Cfap43	UTSW	19	47,768,833 (GRCm39)	missense	probably benign	0.00
R5192:Cfap43	UTSW	19	47,814,364 (GRCm39)	missense	probably damaging	1.00
R5196:Cfap43	UTSW	19	47,814,364 (GRCm39)	missense	probably damaging	1.00
R5197:Cfap43	UTSW	19	47,885,811 (GRCm39)	missense	probably damaging	1.00
R5205:Cfap43	UTSW	19	47,885,987 (GRCm39)	missense	possibly damaging	0.76
R5425:Cfap43	UTSW	19	47,885,371 (GRCm39)	missense	possibly damaging	0.94
R5516:Cfap43	UTSW	19	47,726,648 (GRCm39)	splice site	probably null
R5644:Cfap43	UTSW	19	47,784,114 (GRCm39)	missense	possibly damaging	0.66
R5844:Cfap43	UTSW	19	47,784,135 (GRCm39)	missense	probably benign
R5901:Cfap43	UTSW	19	47,885,538 (GRCm39)	missense	probably damaging	0.97
R5910:Cfap43	UTSW	19	47,768,710 (GRCm39)	missense	possibly damaging	0.63
R5920:Cfap43	UTSW	19	47,749,335 (GRCm39)	missense	possibly damaging	0.88
R5963:Cfap43	UTSW	19	47,734,013 (GRCm39)	missense	probably benign	0.42
R6817:Cfap43	UTSW	19	47,744,524 (GRCm39)	missense	possibly damaging	0.88
R6974:Cfap43	UTSW	19	47,773,717 (GRCm39)	critical splice donor site	probably null
R7219:Cfap43	UTSW	19	47,779,912 (GRCm39)	missense	probably benign	0.02
R7270:Cfap43	UTSW	19	47,728,224 (GRCm39)	missense	possibly damaging	0.86
R7733:Cfap43	UTSW	19	47,886,432 (GRCm39)	missense	possibly damaging	0.75
R7995:Cfap43	UTSW	19	47,886,462 (GRCm39)	missense	probably damaging	1.00
R8013:Cfap43	UTSW	19	47,761,548 (GRCm39)	missense	probably damaging	0.99
R8176:Cfap43	UTSW	19	47,784,114 (GRCm39)	missense	probably benign	0.00
R8242:Cfap43	UTSW	19	47,885,808 (GRCm39)	missense	probably damaging	1.00
R8303:Cfap43	UTSW	19	47,754,274 (GRCm39)	nonsense	probably null
R8333:Cfap43	UTSW	19	47,885,765 (GRCm39)	nonsense	probably null
R8353:Cfap43	UTSW	19	47,735,086 (GRCm39)	missense	probably damaging	1.00
R8453:Cfap43	UTSW	19	47,735,086 (GRCm39)	missense	probably damaging	1.00
R8474:Cfap43	UTSW	19	47,886,363 (GRCm39)	missense	probably benign	0.32
R8478:Cfap43	UTSW	19	47,764,515 (GRCm39)	missense	probably benign	0.02
R8676:Cfap43	UTSW	19	47,736,456 (GRCm39)	missense	possibly damaging	0.95
R8928:Cfap43	UTSW	19	47,804,399 (GRCm39)	missense	probably benign	0.00
R9190:Cfap43	UTSW	19	47,726,293 (GRCm39)	missense	possibly damaging	0.65
R9426:Cfap43	UTSW	19	47,814,237 (GRCm39)	missense	probably damaging	0.99
R9450:Cfap43	UTSW	19	47,886,310 (GRCm39)	missense	probably benign	0.23
R9491:Cfap43	UTSW	19	47,800,505 (GRCm39)	critical splice donor site	probably null
R9515:Cfap43	UTSW	19	47,773,814 (GRCm39)	missense	probably damaging	1.00
R9732:Cfap43	UTSW	19	47,775,446 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCACGAAAGGATGATTCTGCCC -3'
(R):5'- GTCCCTGTGTTCCTCTGAAAGACTG -3'

Sequencing Primer
(F):5'- CGAAAGGATGATTCTGCCCTTTTAG -3'
(R):5'- TTCCTCTGAAAGACTGGAGCAG -3'

Posted On

2013-09-30