Incidental Mutation 'R9328:Gm436'
ID 706636
Institutional Source Beutler Lab
Gene Symbol Gm436
Ensembl Gene ENSMUSG00000078505
Gene Name predicted gene 436
Synonyms LOC230890
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R9328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 144669937-144686368 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144674686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 76 (H76L)
Ref Sequence ENSEMBL: ENSMUSP00000101373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105747]
AlphaFold B1AVU6
Predicted Effect probably benign
Transcript: ENSMUST00000105747
AA Change: H76L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101373
Gene: ENSMUSG00000078505
AA Change: H76L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Abhydrolase_3 115 285 1.6e-29 PFAM
Pfam:Abhydrolase_3 292 381 9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 38,194,848 T102A probably benign Het
1700109H08Rik A G 5: 3,582,161 K164E possibly damaging Het
2410089E03Rik A G 15: 8,186,208 D416G probably damaging Het
2610042L04Rik C T 14: 4,350,013 Q74* probably null Het
Adgrb2 T A 4: 130,021,570 M1381K probably damaging Het
Adgrv1 C A 13: 81,472,404 D3975Y probably damaging Het
Ano10 C T 9: 122,261,102 E382K possibly damaging Het
Ascc3 T C 10: 50,658,919 V636A probably damaging Het
AU040320 T C 4: 126,835,539 V498A possibly damaging Het
Bahcc1 C T 11: 120,275,059 T1047I possibly damaging Het
BC004004 A T 17: 29,282,708 T74S possibly damaging Het
Bend3 A G 10: 43,511,423 D604G possibly damaging Het
Brinp3 T A 1: 146,831,717 V373E probably damaging Het
Bsph2 A T 7: 13,556,839 D38E probably benign Het
Catsperd A G 17: 56,658,074 I474V possibly damaging Het
Ccdc180 A G 4: 45,902,447 N292S possibly damaging Het
Cd1d1 A T 3: 86,998,152 V178E possibly damaging Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Champ1 A G 8: 13,879,392 K517E probably damaging Het
Chrna9 T C 5: 65,971,226 F259S probably damaging Het
Chuk A T 19: 44,096,983 C241* probably null Het
Clns1a A G 7: 97,714,033 Y204C probably benign Het
Cyp2j7 A T 4: 96,227,632 N192K probably damaging Het
Ddr2 A G 1: 170,001,935 V250A probably benign Het
Dlgap2 A G 8: 14,727,441 S229G probably damaging Het
Dmrt1 A T 19: 25,545,867 H194L probably damaging Het
Dock7 A T 4: 99,079,827 F138I Het
Dsg2 T C 18: 20,582,790 V263A possibly damaging Het
Dusp16 A G 6: 134,739,939 L135P probably damaging Het
Dysf A G 6: 84,073,913 N414S probably damaging Het
Efhc1 A G 1: 20,960,374 Y177C probably damaging Het
Fam83e A T 7: 45,723,488 R174S probably benign Het
Fgf4 C T 7: 144,862,927 L199F probably damaging Het
Fignl2 A G 15: 101,053,390 L337P unknown Het
Gatsl3 T C 11: 4,220,423 F140L probably benign Het
Gm15448 T A 7: 3,824,581 R192S unknown Het
Gm4353 T C 7: 116,083,489 R286G probably damaging Het
Gm5142 T C 14: 59,178,677 S11G probably benign Het
Gpr151 A G 18: 42,579,205 V136A probably damaging Het
Ift80 T A 3: 68,940,150 I338F probably damaging Het
Itgb4 A G 11: 115,989,799 S693G probably benign Het
Kif13a T A 13: 46,798,362 I812F probably damaging Het
Krit1 T C 5: 3,812,577 probably null Het
Mapk6 T C 9: 75,397,970 D55G possibly damaging Het
Matn3 A G 12: 8,952,033 I82V possibly damaging Het
Mecom T A 3: 30,009,845 D32V unknown Het
Nacad T C 11: 6,602,417 H258R possibly damaging Het
Ndufaf5 T A 2: 140,188,832 S213T possibly damaging Het
Nphp1 C T 2: 127,740,972 D674N possibly damaging Het
Nsmaf A G 4: 6,426,412 L250P probably damaging Het
Ogdh T C 11: 6,347,838 S571P probably benign Het
Olfr391-ps T C 11: 73,799,652 Y35C probably damaging Het
Olfr641 T A 7: 104,040,061 D88E Het
Olfr944 T C 9: 39,217,879 I174T probably damaging Het
Osbpl11 A G 16: 33,226,875 I403V probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plat A G 8: 22,778,117 R300G probably damaging Het
Ppid T C 3: 79,597,752 I134T probably damaging Het
Rad51ap2 A G 12: 11,457,771 I565V probably benign Het
Rasa1 T C 13: 85,255,456 probably null Het
Sema4a C T 3: 88,438,306 W490* probably null Het
Sept3 A G 15: 82,289,238 Y257C probably damaging Het
Sh3rf2 C A 18: 42,141,096 F442L probably benign Het
Sipa1l1 A G 12: 82,342,018 I339M possibly damaging Het
Six2 T C 17: 85,687,768 N62S possibly damaging Het
Slc44a5 T C 3: 154,259,041 I526T probably benign Het
Smarca5 T C 8: 80,720,749 S402G probably benign Het
Son T A 16: 91,655,757 V464E possibly damaging Het
Sorcs3 A G 19: 48,797,511 K1144E probably damaging Het
Stxbp6 A G 12: 44,855,876 L204P probably damaging Het
Tchh A G 3: 93,444,263 R337G unknown Het
Tgm4 T C 9: 123,056,632 V413A possibly damaging Het
Tmem131 G A 1: 36,819,155 Q704* probably null Het
Tmpo T C 10: 91,162,963 K321E probably damaging Het
Trim75 G T 8: 64,982,663 N378K probably benign Het
Tspan18 T A 2: 93,205,720 I227F probably benign Het
Ttn C T 2: 76,711,182 W33820* probably null Het
Urb2 T A 8: 124,047,295 Y1522N probably damaging Het
Zbtb40 T C 4: 137,018,309 N138D probably benign Het
Zfp715 A T 7: 43,297,904 H877Q possibly damaging Het
Other mutations in Gm436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Gm436 APN 4 144673779 missense probably benign 0.12
IGL01369:Gm436 APN 4 144674645 missense possibly damaging 0.50
IGL01503:Gm436 APN 4 144674567 missense probably damaging 0.99
IGL01505:Gm436 APN 4 144674618 missense probably damaging 1.00
IGL01954:Gm436 APN 4 144670171 missense probably damaging 1.00
IGL02447:Gm436 APN 4 144674699 missense probably benign 0.02
IGL02804:Gm436 APN 4 144670439 missense possibly damaging 0.95
R0373:Gm436 UTSW 4 144686220 missense possibly damaging 0.54
R1124:Gm436 UTSW 4 144670275 missense probably benign 0.00
R1598:Gm436 UTSW 4 144670424 missense possibly damaging 0.60
R1734:Gm436 UTSW 4 144670026 missense probably benign 0.04
R1763:Gm436 UTSW 4 144669959 missense probably benign 0.24
R1968:Gm436 UTSW 4 144670623 missense possibly damaging 0.83
R3055:Gm436 UTSW 4 144674698 missense probably benign 0.16
R3056:Gm436 UTSW 4 144674698 missense probably benign 0.16
R3930:Gm436 UTSW 4 144670128 missense probably damaging 1.00
R5124:Gm436 UTSW 4 144674719 missense probably damaging 1.00
R5407:Gm436 UTSW 4 144670325 missense probably benign 0.01
R6302:Gm436 UTSW 4 144670190 nonsense probably null
R6814:Gm436 UTSW 4 144670646 nonsense probably null
R6872:Gm436 UTSW 4 144670646 nonsense probably null
R6988:Gm436 UTSW 4 144686325 missense probably benign 0.01
R7131:Gm436 UTSW 4 144670067 missense probably damaging 0.98
R7895:Gm436 UTSW 4 144670343 missense possibly damaging 0.95
R8108:Gm436 UTSW 4 144670669 missense probably benign 0.04
R8378:Gm436 UTSW 4 144670599 missense probably benign 0.24
R8676:Gm436 UTSW 4 144670113 missense possibly damaging 0.94
R8817:Gm436 UTSW 4 144673791 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCCTCATGTAAATGTATGC -3'
(R):5'- TGCGCAATGGTAAATGCACC -3'

Sequencing Primer
(F):5'- AACATTCCATCTGTCAGGGG -3'
(R):5'- CCTGAGCAATGCTAAGTGACTGC -3'
Posted On 2022-04-18