Mutagenetix > Incidental Mutations

Incidental Mutation 'R9328:Smarca5'

706656

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9328 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80720749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 402 (S402G)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably benign
Transcript: ENSMUST00000043359
AA Change: S402G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: S402G

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C10Rik	A	G	7: 38,194,848	T102A	probably benign	Het
1700109H08Rik	A	G	5: 3,582,161	K164E	possibly damaging	Het
2410089E03Rik	A	G	15: 8,186,208	D416G	probably damaging	Het
2610042L04Rik	C	T	14: 4,350,013	Q74*	probably null	Het
Adgrb2	T	A	4: 130,021,570	M1381K	probably damaging	Het
Adgrv1	C	A	13: 81,472,404	D3975Y	probably damaging	Het
Ano10	C	T	9: 122,261,102	E382K	possibly damaging	Het
Ascc3	T	C	10: 50,658,919	V636A	probably damaging	Het
AU040320	T	C	4: 126,835,539	V498A	possibly damaging	Het
Bahcc1	C	T	11: 120,275,059	T1047I	possibly damaging	Het
BC004004	A	T	17: 29,282,708	T74S	possibly damaging	Het
Bend3	A	G	10: 43,511,423	D604G	possibly damaging	Het
Brinp3	T	A	1: 146,831,717	V373E	probably damaging	Het
Bsph2	A	T	7: 13,556,839	D38E	probably benign	Het
Catsperd	A	G	17: 56,658,074	I474V	possibly damaging	Het
Ccdc180	A	G	4: 45,902,447	N292S	possibly damaging	Het
Cd1d1	A	T	3: 86,998,152	V178E	possibly damaging	Het
Cdca2	T	A	14: 67,693,682	R521W	probably damaging	Het
Champ1	A	G	8: 13,879,392	K517E	probably damaging	Het
Chrna9	T	C	5: 65,971,226	F259S	probably damaging	Het
Chuk	A	T	19: 44,096,983	C241*	probably null	Het
Clns1a	A	G	7: 97,714,033	Y204C	probably benign	Het
Cyp2j7	A	T	4: 96,227,632	N192K	probably damaging	Het
Ddr2	A	G	1: 170,001,935	V250A	probably benign	Het
Dlgap2	A	G	8: 14,727,441	S229G	probably damaging	Het
Dmrt1	A	T	19: 25,545,867	H194L	probably damaging	Het
Dock7	A	T	4: 99,079,827	F138I		Het
Dsg2	T	C	18: 20,582,790	V263A	possibly damaging	Het
Dusp16	A	G	6: 134,739,939	L135P	probably damaging	Het
Dysf	A	G	6: 84,073,913	N414S	probably damaging	Het
Efhc1	A	G	1: 20,960,374	Y177C	probably damaging	Het
Fam83e	A	T	7: 45,723,488	R174S	probably benign	Het
Fgf4	C	T	7: 144,862,927	L199F	probably damaging	Het
Fignl2	A	G	15: 101,053,390	L337P	unknown	Het
Gatsl3	T	C	11: 4,220,423	F140L	probably benign	Het
Gm15448	T	A	7: 3,824,581	R192S	unknown	Het
Gm4353	T	C	7: 116,083,489	R286G	probably damaging	Het
Gm436	T	A	4: 144,674,686	H76L	probably benign	Het
Gm5142	T	C	14: 59,178,677	S11G	probably benign	Het
Gpr151	A	G	18: 42,579,205	V136A	probably damaging	Het
Ift80	T	A	3: 68,940,150	I338F	probably damaging	Het
Itgb4	A	G	11: 115,989,799	S693G	probably benign	Het
Kif13a	T	A	13: 46,798,362	I812F	probably damaging	Het
Krit1	T	C	5: 3,812,577		probably null	Het
Mapk6	T	C	9: 75,397,970	D55G	possibly damaging	Het
Matn3	A	G	12: 8,952,033	I82V	possibly damaging	Het
Mecom	T	A	3: 30,009,845	D32V	unknown	Het
Nacad	T	C	11: 6,602,417	H258R	possibly damaging	Het
Ndufaf5	T	A	2: 140,188,832	S213T	possibly damaging	Het
Nphp1	C	T	2: 127,740,972	D674N	possibly damaging	Het
Nsmaf	A	G	4: 6,426,412	L250P	probably damaging	Het
Ogdh	T	C	11: 6,347,838	S571P	probably benign	Het
Olfr391-ps	T	C	11: 73,799,652	Y35C	probably damaging	Het
Olfr641	T	A	7: 104,040,061	D88E		Het
Olfr944	T	C	9: 39,217,879	I174T	probably damaging	Het
Osbpl11	A	G	16: 33,226,875	I403V	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Plat	A	G	8: 22,778,117	R300G	probably damaging	Het
Ppid	T	C	3: 79,597,752	I134T	probably damaging	Het
Rad51ap2	A	G	12: 11,457,771	I565V	probably benign	Het
Rasa1	T	C	13: 85,255,456		probably null	Het
Sema4a	C	T	3: 88,438,306	W490*	probably null	Het
Sept3	A	G	15: 82,289,238	Y257C	probably damaging	Het
Sh3rf2	C	A	18: 42,141,096	F442L	probably benign	Het
Sipa1l1	A	G	12: 82,342,018	I339M	possibly damaging	Het
Six2	T	C	17: 85,687,768	N62S	possibly damaging	Het
Slc44a5	T	C	3: 154,259,041	I526T	probably benign	Het
Son	T	A	16: 91,655,757	V464E	possibly damaging	Het
Sorcs3	A	G	19: 48,797,511	K1144E	probably damaging	Het
Stxbp6	A	G	12: 44,855,876	L204P	probably damaging	Het
Tchh	A	G	3: 93,444,263	R337G	unknown	Het
Tgm4	T	C	9: 123,056,632	V413A	possibly damaging	Het
Tmem131	G	A	1: 36,819,155	Q704*	probably null	Het
Tmpo	T	C	10: 91,162,963	K321E	probably damaging	Het
Trim75	G	T	8: 64,982,663	N378K	probably benign	Het
Tspan18	T	A	2: 93,205,720	I227F	probably benign	Het
Ttn	C	T	2: 76,711,182	W33820*	probably null	Het
Urb2	T	A	8: 124,047,295	Y1522N	probably damaging	Het
Zbtb40	T	C	4: 137,018,309	N138D	probably benign	Het
Zfp715	A	T	7: 43,297,904	H877Q	possibly damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCACTGAATTAACAGGTTAAGC -3'
(R):5'- AGCCATGTCTTAAGCAGTGC -3'

Sequencing Primer
(F):5'- GGTTAAGCCTAATCAAGTACACAG -3'
(R):5'- GCCATGTCTTAAGCAGTGCTGAAC -3'

Posted On

2022-04-18