Incidental Mutation 'R9328:Smarca5'
ID 706656
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80720749 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 402 (S402G)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably benign
Transcript: ENSMUST00000043359
AA Change: S402G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: S402G

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 38,194,848 T102A probably benign Het
1700109H08Rik A G 5: 3,582,161 K164E possibly damaging Het
2410089E03Rik A G 15: 8,186,208 D416G probably damaging Het
2610042L04Rik C T 14: 4,350,013 Q74* probably null Het
Adgrb2 T A 4: 130,021,570 M1381K probably damaging Het
Adgrv1 C A 13: 81,472,404 D3975Y probably damaging Het
Ano10 C T 9: 122,261,102 E382K possibly damaging Het
Ascc3 T C 10: 50,658,919 V636A probably damaging Het
AU040320 T C 4: 126,835,539 V498A possibly damaging Het
Bahcc1 C T 11: 120,275,059 T1047I possibly damaging Het
BC004004 A T 17: 29,282,708 T74S possibly damaging Het
Bend3 A G 10: 43,511,423 D604G possibly damaging Het
Brinp3 T A 1: 146,831,717 V373E probably damaging Het
Bsph2 A T 7: 13,556,839 D38E probably benign Het
Catsperd A G 17: 56,658,074 I474V possibly damaging Het
Ccdc180 A G 4: 45,902,447 N292S possibly damaging Het
Cd1d1 A T 3: 86,998,152 V178E possibly damaging Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Champ1 A G 8: 13,879,392 K517E probably damaging Het
Chrna9 T C 5: 65,971,226 F259S probably damaging Het
Chuk A T 19: 44,096,983 C241* probably null Het
Clns1a A G 7: 97,714,033 Y204C probably benign Het
Cyp2j7 A T 4: 96,227,632 N192K probably damaging Het
Ddr2 A G 1: 170,001,935 V250A probably benign Het
Dlgap2 A G 8: 14,727,441 S229G probably damaging Het
Dmrt1 A T 19: 25,545,867 H194L probably damaging Het
Dock7 A T 4: 99,079,827 F138I Het
Dsg2 T C 18: 20,582,790 V263A possibly damaging Het
Dusp16 A G 6: 134,739,939 L135P probably damaging Het
Dysf A G 6: 84,073,913 N414S probably damaging Het
Efhc1 A G 1: 20,960,374 Y177C probably damaging Het
Fam83e A T 7: 45,723,488 R174S probably benign Het
Fgf4 C T 7: 144,862,927 L199F probably damaging Het
Fignl2 A G 15: 101,053,390 L337P unknown Het
Gatsl3 T C 11: 4,220,423 F140L probably benign Het
Gm15448 T A 7: 3,824,581 R192S unknown Het
Gm4353 T C 7: 116,083,489 R286G probably damaging Het
Gm436 T A 4: 144,674,686 H76L probably benign Het
Gm5142 T C 14: 59,178,677 S11G probably benign Het
Gpr151 A G 18: 42,579,205 V136A probably damaging Het
Ift80 T A 3: 68,940,150 I338F probably damaging Het
Itgb4 A G 11: 115,989,799 S693G probably benign Het
Kif13a T A 13: 46,798,362 I812F probably damaging Het
Krit1 T C 5: 3,812,577 probably null Het
Mapk6 T C 9: 75,397,970 D55G possibly damaging Het
Matn3 A G 12: 8,952,033 I82V possibly damaging Het
Mecom T A 3: 30,009,845 D32V unknown Het
Nacad T C 11: 6,602,417 H258R possibly damaging Het
Ndufaf5 T A 2: 140,188,832 S213T possibly damaging Het
Nphp1 C T 2: 127,740,972 D674N possibly damaging Het
Nsmaf A G 4: 6,426,412 L250P probably damaging Het
Ogdh T C 11: 6,347,838 S571P probably benign Het
Olfr391-ps T C 11: 73,799,652 Y35C probably damaging Het
Olfr641 T A 7: 104,040,061 D88E Het
Olfr944 T C 9: 39,217,879 I174T probably damaging Het
Osbpl11 A G 16: 33,226,875 I403V probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plat A G 8: 22,778,117 R300G probably damaging Het
Ppid T C 3: 79,597,752 I134T probably damaging Het
Rad51ap2 A G 12: 11,457,771 I565V probably benign Het
Rasa1 T C 13: 85,255,456 probably null Het
Sema4a C T 3: 88,438,306 W490* probably null Het
Sept3 A G 15: 82,289,238 Y257C probably damaging Het
Sh3rf2 C A 18: 42,141,096 F442L probably benign Het
Sipa1l1 A G 12: 82,342,018 I339M possibly damaging Het
Six2 T C 17: 85,687,768 N62S possibly damaging Het
Slc44a5 T C 3: 154,259,041 I526T probably benign Het
Son T A 16: 91,655,757 V464E possibly damaging Het
Sorcs3 A G 19: 48,797,511 K1144E probably damaging Het
Stxbp6 A G 12: 44,855,876 L204P probably damaging Het
Tchh A G 3: 93,444,263 R337G unknown Het
Tgm4 T C 9: 123,056,632 V413A possibly damaging Het
Tmem131 G A 1: 36,819,155 Q704* probably null Het
Tmpo T C 10: 91,162,963 K321E probably damaging Het
Trim75 G T 8: 64,982,663 N378K probably benign Het
Tspan18 T A 2: 93,205,720 I227F probably benign Het
Ttn C T 2: 76,711,182 W33820* probably null Het
Urb2 T A 8: 124,047,295 Y1522N probably damaging Het
Zbtb40 T C 4: 137,018,309 N138D probably benign Het
Zfp715 A T 7: 43,297,904 H877Q possibly damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Encryption UTSW 8 80704726 missense probably damaging 1.00
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8817:Smarca5 UTSW 8 80733750 missense probably benign
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R8905:Smarca5 UTSW 8 80713948 missense probably benign 0.14
R9018:Smarca5 UTSW 8 80704726 missense probably damaging 1.00
R9028:Smarca5 UTSW 8 80714013 missense probably damaging 1.00
R9203:Smarca5 UTSW 8 80704629 nonsense probably null
R9253:Smarca5 UTSW 8 80719715 missense probably damaging 1.00
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCACTGAATTAACAGGTTAAGC -3'
(R):5'- AGCCATGTCTTAAGCAGTGC -3'

Sequencing Primer
(F):5'- GGTTAAGCCTAATCAAGTACACAG -3'
(R):5'- GCCATGTCTTAAGCAGTGCTGAAC -3'
Posted On 2022-04-18