Incidental Mutation 'R9328:Nacad'
ID 706667
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene Name NAC alpha domain containing
Synonyms mKIAA0363
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9328 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 6597823-6606053 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6602417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 258 (H258R)
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045713]
AlphaFold Q5SWP3
Predicted Effect possibly damaging
Transcript: ENSMUST00000045713
AA Change: H258R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: H258R

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 38,194,848 T102A probably benign Het
1700109H08Rik A G 5: 3,582,161 K164E possibly damaging Het
2410089E03Rik A G 15: 8,186,208 D416G probably damaging Het
2610042L04Rik C T 14: 4,350,013 Q74* probably null Het
Adgrb2 T A 4: 130,021,570 M1381K probably damaging Het
Adgrv1 C A 13: 81,472,404 D3975Y probably damaging Het
Ano10 C T 9: 122,261,102 E382K possibly damaging Het
Ascc3 T C 10: 50,658,919 V636A probably damaging Het
AU040320 T C 4: 126,835,539 V498A possibly damaging Het
Bahcc1 C T 11: 120,275,059 T1047I possibly damaging Het
BC004004 A T 17: 29,282,708 T74S possibly damaging Het
Bend3 A G 10: 43,511,423 D604G possibly damaging Het
Brinp3 T A 1: 146,831,717 V373E probably damaging Het
Bsph2 A T 7: 13,556,839 D38E probably benign Het
Catsperd A G 17: 56,658,074 I474V possibly damaging Het
Ccdc180 A G 4: 45,902,447 N292S possibly damaging Het
Cd1d1 A T 3: 86,998,152 V178E possibly damaging Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Champ1 A G 8: 13,879,392 K517E probably damaging Het
Chrna9 T C 5: 65,971,226 F259S probably damaging Het
Chuk A T 19: 44,096,983 C241* probably null Het
Clns1a A G 7: 97,714,033 Y204C probably benign Het
Cyp2j7 A T 4: 96,227,632 N192K probably damaging Het
Ddr2 A G 1: 170,001,935 V250A probably benign Het
Dlgap2 A G 8: 14,727,441 S229G probably damaging Het
Dmrt1 A T 19: 25,545,867 H194L probably damaging Het
Dock7 A T 4: 99,079,827 F138I Het
Dsg2 T C 18: 20,582,790 V263A possibly damaging Het
Dusp16 A G 6: 134,739,939 L135P probably damaging Het
Dysf A G 6: 84,073,913 N414S probably damaging Het
Efhc1 A G 1: 20,960,374 Y177C probably damaging Het
Fam83e A T 7: 45,723,488 R174S probably benign Het
Fgf4 C T 7: 144,862,927 L199F probably damaging Het
Fignl2 A G 15: 101,053,390 L337P unknown Het
Gatsl3 T C 11: 4,220,423 F140L probably benign Het
Gm15448 T A 7: 3,824,581 R192S unknown Het
Gm4353 T C 7: 116,083,489 R286G probably damaging Het
Gm436 T A 4: 144,674,686 H76L probably benign Het
Gm5142 T C 14: 59,178,677 S11G probably benign Het
Gpr151 A G 18: 42,579,205 V136A probably damaging Het
Ift80 T A 3: 68,940,150 I338F probably damaging Het
Itgb4 A G 11: 115,989,799 S693G probably benign Het
Kif13a T A 13: 46,798,362 I812F probably damaging Het
Krit1 T C 5: 3,812,577 probably null Het
Mapk6 T C 9: 75,397,970 D55G possibly damaging Het
Matn3 A G 12: 8,952,033 I82V possibly damaging Het
Mecom T A 3: 30,009,845 D32V unknown Het
Ndufaf5 T A 2: 140,188,832 S213T possibly damaging Het
Nphp1 C T 2: 127,740,972 D674N possibly damaging Het
Nsmaf A G 4: 6,426,412 L250P probably damaging Het
Ogdh T C 11: 6,347,838 S571P probably benign Het
Olfr391-ps T C 11: 73,799,652 Y35C probably damaging Het
Olfr641 T A 7: 104,040,061 D88E Het
Olfr944 T C 9: 39,217,879 I174T probably damaging Het
Osbpl11 A G 16: 33,226,875 I403V probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plat A G 8: 22,778,117 R300G probably damaging Het
Ppid T C 3: 79,597,752 I134T probably damaging Het
Rad51ap2 A G 12: 11,457,771 I565V probably benign Het
Rasa1 T C 13: 85,255,456 probably null Het
Sema4a C T 3: 88,438,306 W490* probably null Het
Sept3 A G 15: 82,289,238 Y257C probably damaging Het
Sh3rf2 C A 18: 42,141,096 F442L probably benign Het
Sipa1l1 A G 12: 82,342,018 I339M possibly damaging Het
Six2 T C 17: 85,687,768 N62S possibly damaging Het
Slc44a5 T C 3: 154,259,041 I526T probably benign Het
Smarca5 T C 8: 80,720,749 S402G probably benign Het
Son T A 16: 91,655,757 V464E possibly damaging Het
Sorcs3 A G 19: 48,797,511 K1144E probably damaging Het
Stxbp6 A G 12: 44,855,876 L204P probably damaging Het
Tchh A G 3: 93,444,263 R337G unknown Het
Tgm4 T C 9: 123,056,632 V413A possibly damaging Het
Tmem131 G A 1: 36,819,155 Q704* probably null Het
Tmpo T C 10: 91,162,963 K321E probably damaging Het
Trim75 G T 8: 64,982,663 N378K probably benign Het
Tspan18 T A 2: 93,205,720 I227F probably benign Het
Ttn C T 2: 76,711,182 W33820* probably null Het
Urb2 T A 8: 124,047,295 Y1522N probably damaging Het
Zbtb40 T C 4: 137,018,309 N138D probably benign Het
Zfp715 A T 7: 43,297,904 H877Q possibly damaging Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6600921 missense probably benign 0.24
IGL00903:Nacad APN 11 6600632 missense probably damaging 0.99
IGL01303:Nacad APN 11 6598279 missense possibly damaging 0.81
IGL01353:Nacad APN 11 6600530 missense possibly damaging 0.70
IGL01833:Nacad APN 11 6605700 missense unknown
IGL02267:Nacad APN 11 6602649 missense probably benign 0.14
IGL02531:Nacad APN 11 6598580 missense possibly damaging 0.90
IGL02994:Nacad APN 11 6599528 missense possibly damaging 0.83
IGL03121:Nacad APN 11 6600933 missense probably damaging 0.98
IGL03161:Nacad APN 11 6600378 nonsense probably null
Locusta UTSW 11 6602387 missense possibly damaging 0.88
migratoria UTSW 11 6601196 missense probably benign 0.30
FR4340:Nacad UTSW 11 6599761 small insertion probably benign
FR4342:Nacad UTSW 11 6599762 small insertion probably benign
FR4548:Nacad UTSW 11 6599752 small insertion probably benign
FR4548:Nacad UTSW 11 6599760 small insertion probably benign
FR4589:Nacad UTSW 11 6599753 small insertion probably benign
FR4976:Nacad UTSW 11 6599749 small insertion probably benign
FR4976:Nacad UTSW 11 6599756 small insertion probably benign
FR4976:Nacad UTSW 11 6599763 small insertion probably benign
PIT4402001:Nacad UTSW 11 6598621 missense probably benign 0.19
R0330:Nacad UTSW 11 6600903 missense probably benign
R0331:Nacad UTSW 11 6599441 missense possibly damaging 0.84
R0409:Nacad UTSW 11 6599810 missense probably benign 0.00
R0612:Nacad UTSW 11 6601382 missense possibly damaging 0.90
R0644:Nacad UTSW 11 6599486 missense possibly damaging 0.69
R0829:Nacad UTSW 11 6601158 missense probably benign 0.18
R1483:Nacad UTSW 11 6602217 missense probably damaging 0.99
R1583:Nacad UTSW 11 6601185 missense probably benign 0.08
R1905:Nacad UTSW 11 6602540 missense probably benign 0.15
R1907:Nacad UTSW 11 6602540 missense probably benign 0.15
R2361:Nacad UTSW 11 6600821 missense probably benign
R2979:Nacad UTSW 11 6601424 missense probably benign 0.06
R4192:Nacad UTSW 11 6605534 missense probably benign 0.44
R4381:Nacad UTSW 11 6600204 missense probably benign 0.18
R4539:Nacad UTSW 11 6600677 missense possibly damaging 0.94
R4751:Nacad UTSW 11 6605726 missense unknown
R4944:Nacad UTSW 11 6598507 missense possibly damaging 0.95
R4962:Nacad UTSW 11 6599169 missense probably damaging 1.00
R5102:Nacad UTSW 11 6598528 missense probably damaging 1.00
R5189:Nacad UTSW 11 6601611 missense probably damaging 0.98
R5296:Nacad UTSW 11 6605745 missense unknown
R5566:Nacad UTSW 11 6602136 missense probably damaging 1.00
R5634:Nacad UTSW 11 6602387 missense possibly damaging 0.88
R5725:Nacad UTSW 11 6601643 missense probably benign 0.15
R5748:Nacad UTSW 11 6598370 nonsense probably null
R5864:Nacad UTSW 11 6600581 missense probably benign
R5882:Nacad UTSW 11 6598568 missense possibly damaging 0.95
R6089:Nacad UTSW 11 6601331 missense probably benign 0.03
R6117:Nacad UTSW 11 6599810 missense probably benign 0.00
R6161:Nacad UTSW 11 6600902 missense probably benign
R6351:Nacad UTSW 11 6599235 missense probably damaging 1.00
R6351:Nacad UTSW 11 6600165 nonsense probably null
R6366:Nacad UTSW 11 6601196 missense probably benign 0.30
R6525:Nacad UTSW 11 6602255 missense probably damaging 1.00
R6811:Nacad UTSW 11 6599400 missense possibly damaging 0.66
R6931:Nacad UTSW 11 6601877 missense probably benign 0.14
R6966:Nacad UTSW 11 6602634 missense possibly damaging 0.93
R7228:Nacad UTSW 11 6598412 missense probably benign 0.19
R7248:Nacad UTSW 11 6598589 nonsense probably null
R7556:Nacad UTSW 11 6601272 missense possibly damaging 0.90
R7594:Nacad UTSW 11 6602457 missense probably damaging 0.99
R7813:Nacad UTSW 11 6599071 missense probably benign 0.38
R7841:Nacad UTSW 11 6601031 missense probably benign 0.00
R8243:Nacad UTSW 11 6602643 missense probably damaging 0.96
R8810:Nacad UTSW 11 6602853 missense probably benign 0.15
R9042:Nacad UTSW 11 6598948 missense possibly damaging 0.95
R9057:Nacad UTSW 11 6600876 missense possibly damaging 0.53
R9114:Nacad UTSW 11 6602252 missense probably damaging 1.00
R9394:Nacad UTSW 11 6599390 missense probably damaging 1.00
R9595:Nacad UTSW 11 6601790 missense probably damaging 0.99
T0975:Nacad UTSW 11 6599750 small insertion probably benign
T0975:Nacad UTSW 11 6601622 missense probably benign 0.03
T0975:Nacad UTSW 11 6601632 missense probably benign 0.17
X0011:Nacad UTSW 11 6601074 missense probably benign 0.00
Z1176:Nacad UTSW 11 6602297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGGTCATCTGCCACTGAC -3'
(R):5'- CAGGTCATCGCTTCACCTAG -3'

Sequencing Primer
(F):5'- ATCTGCCACTGACCCTGATGG -3'
(R):5'- TCATCGCTTCACCTAGGGCAG -3'
Posted On 2022-04-18