Mutagenetix > Incidental Mutations

Incidental Mutation 'R0741:Pnkd'

70667

Institutional Source

Beutler Lab

Gene Symbol

Pnkd

Ensembl Gene

ENSMUSG00000026179

Gene Name

paroxysmal nonkinesiogenic dyskinesia

Synonyms

2810403H05Rik, Brp17, 2210013N15Rik

MMRRC Submission

038922-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R0741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74284930-74353694 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74351859 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 337 (S337R)

Ref Sequence

ENSEMBL: ENSMUSP00000084477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027370] [ENSMUST00000087225] [ENSMUST00000087226]

Predicted Effect

probably benign
Transcript: ENSMUST00000027370
AA Change: S362R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179
AA Change: S362R

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	4	79	1e-24	BLAST
Lactamase_B	129	291	1.05e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087225
AA Change: S337R

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000084477
Gene: ENSMUSG00000026179
AA Change: S337R

Domain	Start	End	E-Value	Type
transmembrane domain	6	28	N/A	INTRINSIC
transmembrane domain	49	68	N/A	INTRINSIC
Lactamase_B	104	266	1.05e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000087226
AA Change: S401R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179
AA Change: S401R

Domain	Start	End	E-Value	Type
low complexity region	43	61	N/A	INTRINSIC
Pfam:DUF4748	71	121	2.9e-23	PFAM
Lactamase_B	168	330	1.05e-31	SMART
Pfam:HAGH_C	331	421	6.2e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138620

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased levels of the dopamine metabolite 3,4-dihydroxyphenylacetic acid (DOPAC) and lower DOPAC/dopamine ratios after injection of caffeine or ethanol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano7	T	A	1: 93,401,587	I701N	probably damaging	Het
Asb7	A	T	7: 66,660,134	N111K	probably benign	Het
Atp10a	T	A	7: 58,828,589	L1460Q	possibly damaging	Het
Auh	T	C	13: 52,929,602	T14A	possibly damaging	Het
Caskin2	A	G	11: 115,804,800	V245A	probably damaging	Het
Cryba4	G	A	5: 112,246,688	R192C	probably damaging	Het
Ctsq	T	A	13: 61,036,205	D301V	probably damaging	Het
Dpyd	A	G	3: 118,674,505	E56G	possibly damaging	Het
Dtd2	T	C	12: 51,999,672	K128R	probably benign	Het
Eps8l3	A	G	3: 107,882,825	T141A	probably benign	Het
Evc	A	T	5: 37,326,395	I187N	possibly damaging	Het
Fam120a	A	G	13: 48,891,940	S807P	possibly damaging	Het
Fbxw22	G	A	9: 109,382,219	S338L	probably benign	Het
Gcnt4	G	T	13: 96,946,432	E79*	probably null	Het
Get4	G	A	5: 139,263,629		probably benign	Het
Hipk1	A	G	3: 103,746,812	V954A	probably benign	Het
Ifi206	C	T	1: 173,473,749	V788M	probably benign	Het
Iqgap1	A	G	7: 80,720,987	S1545P	probably benign	Het
Kif21b	A	G	1: 136,159,744	T933A	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Magee2	A	G	X: 104,855,866	L393P	probably damaging	Het
Mtrr	T	C	13: 68,579,539		probably null	Het
Nes	A	G	3: 87,978,967	E1467G	probably damaging	Het
Nol3	C	G	8: 105,279,124	A50G	probably damaging	Het
Nr2f2	G	A	7: 70,357,997	R113C	probably damaging	Het
Obscn	CCACACACACACAC	CCACACACACAC	11: 59,063,453		probably null	Het
Olfr512	T	A	7: 108,713,604	C84S	probably benign	Het
Ptprh	A	G	7: 4,554,173		probably null	Het
Ralgapa1	A	C	12: 55,676,581	V1767G	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Skap1	A	C	11: 96,492,933		probably benign	Het
Trip12	A	G	1: 84,745,181	S1250P	probably benign	Het
Txndc5	T	C	13: 38,528,260	H50R	possibly damaging	Het
Usp25	C	A	16: 77,071,708	D332E	possibly damaging	Het
Vgll1	A	T	X: 57,096,284		probably benign	Het

Other mutations in Pnkd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Pnkd	APN	1	74285922	missense	probably damaging	1.00
IGL01322:Pnkd	APN	1	74351557	missense	probably damaging	1.00
IGL02536:Pnkd	APN	1	74351900	missense	probably damaging	1.00
IGL02712:Pnkd	APN	1	74349868	missense	possibly damaging	0.62
R0731:Pnkd	UTSW	1	74351541	missense	probably damaging	1.00
R1483:Pnkd	UTSW	1	74349391	missense	probably benign	0.08
R1497:Pnkd	UTSW	1	74351522	splice site	probably null
R1515:Pnkd	UTSW	1	74349809	missense	probably null	1.00
R1759:Pnkd	UTSW	1	74348763	missense	probably damaging	0.98
R1969:Pnkd	UTSW	1	74351849	missense	probably damaging	0.97
R1970:Pnkd	UTSW	1	74285910	unclassified	probably null
R3508:Pnkd	UTSW	1	74350634	missense	probably benign	0.01
R4714:Pnkd	UTSW	1	74351782	missense	probably damaging	1.00
R4811:Pnkd	UTSW	1	74349405	splice site	probably null
R5437:Pnkd	UTSW	1	74349737	missense	possibly damaging	0.61
R5931:Pnkd	UTSW	1	74350674	missense	probably benign
R6698:Pnkd	UTSW	1	74350677	missense	probably damaging	1.00
R6994:Pnkd	UTSW	1	74293176	intron	probably null

Predicted Primers

PCR Primer
(F):5'- GGTAGGCAGACATCCCTGCATTTC -3'
(R):5'- CATGATCTGGCGATTGGTCCATGAG -3'

Sequencing Primer
(F):5'- GACATCCCTGCATTTCCAGTTTC -3'
(R):5'- tggtggtggtggtggtg -3'

Posted On

2013-09-30