Incidental Mutation 'R0741:Pnkd'
ID70667
Institutional Source Beutler Lab
Gene Symbol Pnkd
Ensembl Gene ENSMUSG00000026179
Gene Nameparoxysmal nonkinesiogenic dyskinesia
Synonyms2810403H05Rik, Brp17, 2210013N15Rik
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74284930-74353694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74351859 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 337 (S337R)
Ref Sequence ENSEMBL: ENSMUSP00000084477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027370] [ENSMUST00000087225] [ENSMUST00000087226]
Predicted Effect probably benign
Transcript: ENSMUST00000027370
AA Change: S362R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179
AA Change: S362R

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087225
AA Change: S337R

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084477
Gene: ENSMUSG00000026179
AA Change: S337R

DomainStartEndE-ValueType
transmembrane domain 6 28 N/A INTRINSIC
transmembrane domain 49 68 N/A INTRINSIC
Lactamase_B 104 266 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087226
AA Change: S401R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179
AA Change: S401R

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased levels of the dopamine metabolite 3,4-dihydroxyphenylacetic acid (DOPAC) and lower DOPAC/dopamine ratios after injection of caffeine or ethanol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Pnkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Pnkd APN 1 74285922 missense probably damaging 1.00
IGL01322:Pnkd APN 1 74351557 missense probably damaging 1.00
IGL02536:Pnkd APN 1 74351900 missense probably damaging 1.00
IGL02712:Pnkd APN 1 74349868 missense possibly damaging 0.62
R0731:Pnkd UTSW 1 74351541 missense probably damaging 1.00
R1483:Pnkd UTSW 1 74349391 missense probably benign 0.08
R1497:Pnkd UTSW 1 74351522 splice site probably null
R1515:Pnkd UTSW 1 74349809 missense probably null 1.00
R1759:Pnkd UTSW 1 74348763 missense probably damaging 0.98
R1969:Pnkd UTSW 1 74351849 missense probably damaging 0.97
R1970:Pnkd UTSW 1 74285910 unclassified probably null
R3508:Pnkd UTSW 1 74350634 missense probably benign 0.01
R4714:Pnkd UTSW 1 74351782 missense probably damaging 1.00
R4811:Pnkd UTSW 1 74349405 splice site probably null
R5437:Pnkd UTSW 1 74349737 missense possibly damaging 0.61
R5931:Pnkd UTSW 1 74350674 missense probably benign
R6698:Pnkd UTSW 1 74350677 missense probably damaging 1.00
R6994:Pnkd UTSW 1 74293176 intron probably null
Predicted Primers PCR Primer
(F):5'- GGTAGGCAGACATCCCTGCATTTC -3'
(R):5'- CATGATCTGGCGATTGGTCCATGAG -3'

Sequencing Primer
(F):5'- GACATCCCTGCATTTCCAGTTTC -3'
(R):5'- tggtggtggtggtggtg -3'
Posted On2013-09-30