Incidental Mutation 'R0741:Trip12'
ID70668
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84745181 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1250 (S1250P)
Ref Sequence ENSEMBL: ENSMUSP00000139563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]
Predicted Effect probably benign
Transcript: ENSMUST00000027421
AA Change: S1283P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: S1283P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186465
AA Change: S1283P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: S1283P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186648
AA Change: S1250P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: S1250P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189670
SMART Domains Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 138 149 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
Blast:HECTc 168 222 5e-8 BLAST
Blast:HECTc 378 434 1e-24 BLAST
HECTc 441 830 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189841
SMART Domains Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 51 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190125
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATAGCTTGCACCAGAGCCAG -3'
(R):5'- GGTGAGTGTGCCCAGATAGTTGAAG -3'

Sequencing Primer
(F):5'- GCCAGGGGATCAATCTTGAC -3'
(R):5'- CCAGTAGGTACAGCATTTCATTGAG -3'
Posted On2013-09-30