Mutagenetix > Incidental Mutation

Incidental Mutation 'R9328:Dsg2'

706689

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R9328 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20582790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 263 (V263A)

Ref Sequence

ENSEMBL: ENSMUSP00000057096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]

AlphaFold

O55111

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059787
AA Change: V263A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: V263A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120102
AA Change: V263A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: V263A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
Pfam:Cadherin	282	347	6.9e-10	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121837
AA Change: V263A

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393
AA Change: V263A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C10Rik	A	G	7: 38,194,848	T102A	probably benign	Het
1700109H08Rik	A	G	5: 3,582,161	K164E	possibly damaging	Het
2410089E03Rik	A	G	15: 8,186,208	D416G	probably damaging	Het
2610042L04Rik	C	T	14: 4,350,013	Q74*	probably null	Het
Adgrb2	T	A	4: 130,021,570	M1381K	probably damaging	Het
Adgrv1	C	A	13: 81,472,404	D3975Y	probably damaging	Het
Ano10	C	T	9: 122,261,102	E382K	possibly damaging	Het
Ascc3	T	C	10: 50,658,919	V636A	probably damaging	Het
AU040320	T	C	4: 126,835,539	V498A	possibly damaging	Het
Bahcc1	C	T	11: 120,275,059	T1047I	possibly damaging	Het
BC004004	A	T	17: 29,282,708	T74S	possibly damaging	Het
Bend3	A	G	10: 43,511,423	D604G	possibly damaging	Het
Brinp3	T	A	1: 146,831,717	V373E	probably damaging	Het
Bsph2	A	T	7: 13,556,839	D38E	probably benign	Het
Catsperd	A	G	17: 56,658,074	I474V	possibly damaging	Het
Ccdc180	A	G	4: 45,902,447	N292S	possibly damaging	Het
Cd1d1	A	T	3: 86,998,152	V178E	possibly damaging	Het
Cdca2	T	A	14: 67,693,682	R521W	probably damaging	Het
Champ1	A	G	8: 13,879,392	K517E	probably damaging	Het
Chrna9	T	C	5: 65,971,226	F259S	probably damaging	Het
Chuk	A	T	19: 44,096,983	C241*	probably null	Het
Clns1a	A	G	7: 97,714,033	Y204C	probably benign	Het
Cyp2j7	A	T	4: 96,227,632	N192K	probably damaging	Het
Ddr2	A	G	1: 170,001,935	V250A	probably benign	Het
Dlgap2	A	G	8: 14,727,441	S229G	probably damaging	Het
Dmrt1	A	T	19: 25,545,867	H194L	probably damaging	Het
Dock7	A	T	4: 99,079,827	F138I		Het
Dusp16	A	G	6: 134,739,939	L135P	probably damaging	Het
Dysf	A	G	6: 84,073,913	N414S	probably damaging	Het
Efhc1	A	G	1: 20,960,374	Y177C	probably damaging	Het
Fam83e	A	T	7: 45,723,488	R174S	probably benign	Het
Fgf4	C	T	7: 144,862,927	L199F	probably damaging	Het
Fignl2	A	G	15: 101,053,390	L337P	unknown	Het
Gatsl3	T	C	11: 4,220,423	F140L	probably benign	Het
Gm15448	T	A	7: 3,824,581	R192S	unknown	Het
Gm4353	T	C	7: 116,083,489	R286G	probably damaging	Het
Gm436	T	A	4: 144,674,686	H76L	probably benign	Het
Gm5142	T	C	14: 59,178,677	S11G	probably benign	Het
Gpr151	A	G	18: 42,579,205	V136A	probably damaging	Het
Ift80	T	A	3: 68,940,150	I338F	probably damaging	Het
Itgb4	A	G	11: 115,989,799	S693G	probably benign	Het
Kif13a	T	A	13: 46,798,362	I812F	probably damaging	Het
Krit1	T	C	5: 3,812,577		probably null	Het
Mapk6	T	C	9: 75,397,970	D55G	possibly damaging	Het
Matn3	A	G	12: 8,952,033	I82V	possibly damaging	Het
Mecom	T	A	3: 30,009,845	D32V	unknown	Het
Nacad	T	C	11: 6,602,417	H258R	possibly damaging	Het
Ndufaf5	T	A	2: 140,188,832	S213T	possibly damaging	Het
Nphp1	C	T	2: 127,740,972	D674N	possibly damaging	Het
Nsmaf	A	G	4: 6,426,412	L250P	probably damaging	Het
Ogdh	T	C	11: 6,347,838	S571P	probably benign	Het
Olfr391-ps	T	C	11: 73,799,652	Y35C	probably damaging	Het
Olfr641	T	A	7: 104,040,061	D88E		Het
Olfr944	T	C	9: 39,217,879	I174T	probably damaging	Het
Osbpl11	A	G	16: 33,226,875	I403V	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Plat	A	G	8: 22,778,117	R300G	probably damaging	Het
Ppid	T	C	3: 79,597,752	I134T	probably damaging	Het
Rad51ap2	A	G	12: 11,457,771	I565V	probably benign	Het
Rasa1	T	C	13: 85,255,456		probably null	Het
Sema4a	C	T	3: 88,438,306	W490*	probably null	Het
Sept3	A	G	15: 82,289,238	Y257C	probably damaging	Het
Sh3rf2	C	A	18: 42,141,096	F442L	probably benign	Het
Sipa1l1	A	G	12: 82,342,018	I339M	possibly damaging	Het
Six2	T	C	17: 85,687,768	N62S	possibly damaging	Het
Slc44a5	T	C	3: 154,259,041	I526T	probably benign	Het
Smarca5	T	C	8: 80,720,749	S402G	probably benign	Het
Son	T	A	16: 91,655,757	V464E	possibly damaging	Het
Sorcs3	A	G	19: 48,797,511	K1144E	probably damaging	Het
Stxbp6	A	G	12: 44,855,876	L204P	probably damaging	Het
Tchh	A	G	3: 93,444,263	R337G	unknown	Het
Tgm4	T	C	9: 123,056,632	V413A	possibly damaging	Het
Tmem131	G	A	1: 36,819,155	Q704*	probably null	Het
Tmpo	T	C	10: 91,162,963	K321E	probably damaging	Het
Trim75	G	T	8: 64,982,663	N378K	probably benign	Het
Tspan18	T	A	2: 93,205,720	I227F	probably benign	Het
Ttn	C	T	2: 76,711,182	W33820*	probably null	Het
Urb2	T	A	8: 124,047,295	Y1522N	probably damaging	Het
Zbtb40	T	C	4: 137,018,309	N138D	probably benign	Het
Zfp715	A	T	7: 43,297,904	H877Q	possibly damaging	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1543:Dsg2	UTSW	18	20594211	missense	probably benign	0.33
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1946:Dsg2	UTSW	18	20580548	missense	probably damaging	1.00
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R1992:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably benign
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2343:Dsg2	UTSW	18	20602298	missense	probably damaging	0.99
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08
R7558:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R8094:Dsg2	UTSW	18	20583004	unclassified	probably benign
R8118:Dsg2	UTSW	18	20582801	missense	probably benign	0.11
R8157:Dsg2	UTSW	18	20580549	missense	probably damaging	1.00
R8307:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8308:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8488:Dsg2	UTSW	18	20601374	missense	probably damaging	1.00
R8520:Dsg2	UTSW	18	20579451	missense	probably damaging	1.00
R8669:Dsg2	UTSW	18	20590075	missense	probably damaging	1.00
R8675:Dsg2	UTSW	18	20601918	missense	possibly damaging	0.75
R8750:Dsg2	UTSW	18	20575012	missense	possibly damaging	0.90
R8773:Dsg2	UTSW	18	20582999	missense	probably damaging	1.00
R8888:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8895:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8912:Dsg2	UTSW	18	20582821	missense	probably damaging	1.00
R8925:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R8927:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R9263:Dsg2	UTSW	18	20594166	missense	probably benign	0.33
Z1176:Dsg2	UTSW	18	20580621	missense	probably damaging	1.00
Z1177:Dsg2	UTSW	18	20602249	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GACTGCAGTCCATTTCCTAAAC -3'
(R):5'- GGTCACTTTGATCCGCATGAC -3'

Sequencing Primer
(F):5'- GTCCATTTCCTAAACATAAGGTGACC -3'
(R):5'- GCATGACTTCTACATTGACCTGG -3'

Posted On

2022-04-18