Mutagenetix > Incidental Mutations

Incidental Mutation 'R9329:Ttll4'

706696

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R9329 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74685962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 625 (I625N)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042125
AA Change: I625N

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: I625N

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113678
AA Change: I625N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: I625N

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	T	G	6: 83,156,574	M1R	probably null	Het
4932415D10Rik	G	A	10: 82,285,605	S3857L	probably benign	Het
Acap2	T	C	16: 31,127,420	D235G	probably damaging	Het
Adgrv1	C	A	13: 81,499,122	V3100F	probably damaging	Het
Aff4	A	G	11: 53,397,859	T401A	probably damaging	Het
Apcs	T	C	1: 172,894,824	T22A	probably benign	Het
Atf7ip2	T	C	16: 10,241,874	V426A	possibly damaging	Het
Bach2	A	G	4: 32,562,175	D214G	possibly damaging	Het
Baz2a	C	T	10: 128,125,056	A1578V	possibly damaging	Het
Camk1d	T	C	2: 5,445,143	I76V	probably benign	Het
Ccdc182	A	T	11: 88,294,498	M135L	probably benign	Het
Cd47	C	T	16: 49,896,368	T201I		Het
Chodl	T	C	16: 78,949,142	S290P	possibly damaging	Het
Chst15	A	G	7: 132,266,791	L300P	possibly damaging	Het
Ciita	T	C	16: 10,506,707	S168P	probably damaging	Het
Cntn2	C	T	1: 132,528,940	V123I	probably benign	Het
Cyld	T	A	8: 88,730,720	L527Q	probably benign	Het
Dbn1	T	A	13: 55,483,428	Y34F	probably damaging	Het
Enc1	C	A	13: 97,246,510	Y509*	probably null	Het
Ermard	A	T	17: 15,053,381	E409D	probably benign	Het
Extl3	T	C	14: 65,077,316	E139G	possibly damaging	Het
Fa2h	A	T	8: 111,355,483	V177E	possibly damaging	Het
Flot2	T	C	11: 78,058,946	I367T	probably damaging	Het
Fras1	T	C	5: 96,736,954	Y2564H	probably damaging	Het
Fxyd3	A	G	7: 31,073,593	V10A	probably benign	Het
Gfra3	A	G	18: 34,704,507	L146P	probably damaging	Het
Gm49359	T	C	13: 62,454,634	N251D	probably benign	Het
Hps6	A	G	19: 46,004,103	S160G	probably benign	Het
Hsd17b7	C	A	1: 169,967,306	A55S	probably damaging	Het
Hspa12a	T	C	19: 58,800,866	D446G	probably benign	Het
Htt	G	A	5: 34,832,613	R1163Q	possibly damaging	Het
Ift81	T	C	5: 122,559,770		probably null	Het
Ighv5-15	T	G	12: 113,826,775	Y75S	probably benign	Het
Kcnd2	T	A	6: 21,725,982	H491Q	probably damaging	Het
Lamb3	C	A	1: 193,332,357	T608K	probably benign	Het
Lrtm2	T	A	6: 119,320,451	K210*	probably null	Het
Med13	G	T	11: 86,298,457	P1209T	probably benign	Het
Mtus1	G	A	8: 41,084,202	T159I	probably damaging	Het
Myt1l	A	G	12: 29,851,660	M805V	unknown	Het
Neb	G	T	2: 52,270,219	L2261I	probably benign	Het
Nlrp4c	G	A	7: 6,065,499	R133H	probably benign	Het
Nol11	A	T	11: 107,180,939	L276Q	probably damaging	Het
Nrap	A	G	19: 56,361,845	Y614H	probably damaging	Het
Olfr656	A	G	7: 104,618,498	H273R	probably damaging	Het
Pou2f3	A	G	9: 43,128,929	S355P	probably damaging	Het
Ppm1l	C	A	3: 69,553,120	N343K	probably damaging	Het
Prh1	A	T	6: 132,571,610	I27F	unknown	Het
Prkrip1	A	T	5: 136,194,349	L85Q	probably damaging	Het
Pycrl	C	T	15: 75,918,714	V99I	probably benign	Het
R3hdm4	T	A	10: 79,913,559	N72I	probably damaging	Het
Rab11fip3	G	T	17: 26,012,058	H738N	probably benign	Het
Rtl1	G	A	12: 109,590,239	A1722V	possibly damaging	Het
Sell	A	G	1: 164,065,553	N113D	probably damaging	Het
Smarcal1	T	C	1: 72,626,538	S732P	probably damaging	Het
Smurf2	A	T	11: 106,852,598	D207E	probably benign	Het
Tat	C	T	8: 109,996,878	R333C	probably benign	Het
Tmem121b	A	T	6: 120,492,273	F494L	probably damaging	Het
Tmem198	C	A	1: 75,479,878	P89Q	probably damaging	Het
Tnks2	T	G	19: 36,857,884	C2G	probably damaging	Het
Trappc9	T	C	15: 72,801,353	E869G	unknown	Het
Trim42	T	A	9: 97,369,531	K105M	probably benign	Het
Ttll3	T	C	6: 113,392,674	S60P	probably benign	Het
Tubgcp5	T	A	7: 55,829,433		probably null	Het
Txlnb	A	T	10: 17,806,846	Y172F	probably damaging	Het
Ube2e3	A	T	2: 78,913,691	D88V	possibly damaging	Het
Vmn1r189	T	A	13: 22,102,260	I136L	probably benign	Het
Vmn2r71	A	G	7: 85,618,742	I135V	probably benign	Het
Vmn2r73	T	A	7: 85,869,865	R516S	probably benign	Het
Wrn	C	T	8: 33,240,978	E1352K	probably benign	Het
Zfp318	T	C	17: 46,411,213	S1381P	probably damaging	Het
Zfp747	A	T	7: 127,374,483	Y172N	probably damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGTAGTGACCTATCTGCTCAGG -3'
(R):5'- TGGCTCTCAATTCTGGGCAG -3'

Sequencing Primer
(F):5'- CCTATCTGCTCAGGAAAGGGTG -3'
(R):5'- GCTGGATGAGCTCAGAGGACTTTC -3'

Posted On

2022-04-18