Incidental Mutation 'R9329:Ttll4'
ID 706696
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9329 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74661745-74703730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74685962 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 625 (I625N)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect possibly damaging
Transcript: ENSMUST00000042125
AA Change: I625N

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: I625N

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113678
AA Change: I625N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: I625N

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T G 6: 83,156,574 M1R probably null Het
4932415D10Rik G A 10: 82,285,605 S3857L probably benign Het
Acap2 T C 16: 31,127,420 D235G probably damaging Het
Adgrv1 C A 13: 81,499,122 V3100F probably damaging Het
Aff4 A G 11: 53,397,859 T401A probably damaging Het
Apcs T C 1: 172,894,824 T22A probably benign Het
Atf7ip2 T C 16: 10,241,874 V426A possibly damaging Het
Bach2 A G 4: 32,562,175 D214G possibly damaging Het
Baz2a C T 10: 128,125,056 A1578V possibly damaging Het
Camk1d T C 2: 5,445,143 I76V probably benign Het
Ccdc182 A T 11: 88,294,498 M135L probably benign Het
Cd47 C T 16: 49,896,368 T201I Het
Chodl T C 16: 78,949,142 S290P possibly damaging Het
Chst15 A G 7: 132,266,791 L300P possibly damaging Het
Ciita T C 16: 10,506,707 S168P probably damaging Het
Cntn2 C T 1: 132,528,940 V123I probably benign Het
Cyld T A 8: 88,730,720 L527Q probably benign Het
Dbn1 T A 13: 55,483,428 Y34F probably damaging Het
Enc1 C A 13: 97,246,510 Y509* probably null Het
Ermard A T 17: 15,053,381 E409D probably benign Het
Extl3 T C 14: 65,077,316 E139G possibly damaging Het
Fa2h A T 8: 111,355,483 V177E possibly damaging Het
Flot2 T C 11: 78,058,946 I367T probably damaging Het
Fras1 T C 5: 96,736,954 Y2564H probably damaging Het
Fxyd3 A G 7: 31,073,593 V10A probably benign Het
Gfra3 A G 18: 34,704,507 L146P probably damaging Het
Gm49359 T C 13: 62,454,634 N251D probably benign Het
Hps6 A G 19: 46,004,103 S160G probably benign Het
Hsd17b7 C A 1: 169,967,306 A55S probably damaging Het
Hspa12a T C 19: 58,800,866 D446G probably benign Het
Htt G A 5: 34,832,613 R1163Q possibly damaging Het
Ift81 T C 5: 122,559,770 probably null Het
Ighv5-15 T G 12: 113,826,775 Y75S probably benign Het
Kcnd2 T A 6: 21,725,982 H491Q probably damaging Het
Lamb3 C A 1: 193,332,357 T608K probably benign Het
Lrtm2 T A 6: 119,320,451 K210* probably null Het
Med13 G T 11: 86,298,457 P1209T probably benign Het
Mtus1 G A 8: 41,084,202 T159I probably damaging Het
Myt1l A G 12: 29,851,660 M805V unknown Het
Neb G T 2: 52,270,219 L2261I probably benign Het
Nlrp4c G A 7: 6,065,499 R133H probably benign Het
Nol11 A T 11: 107,180,939 L276Q probably damaging Het
Nrap A G 19: 56,361,845 Y614H probably damaging Het
Olfr656 A G 7: 104,618,498 H273R probably damaging Het
Pou2f3 A G 9: 43,128,929 S355P probably damaging Het
Ppm1l C A 3: 69,553,120 N343K probably damaging Het
Prh1 A T 6: 132,571,610 I27F unknown Het
Prkrip1 A T 5: 136,194,349 L85Q probably damaging Het
Pycrl C T 15: 75,918,714 V99I probably benign Het
R3hdm4 T A 10: 79,913,559 N72I probably damaging Het
Rab11fip3 G T 17: 26,012,058 H738N probably benign Het
Rtl1 G A 12: 109,590,239 A1722V possibly damaging Het
Sell A G 1: 164,065,553 N113D probably damaging Het
Smarcal1 T C 1: 72,626,538 S732P probably damaging Het
Smurf2 A T 11: 106,852,598 D207E probably benign Het
Tat C T 8: 109,996,878 R333C probably benign Het
Tmem121b A T 6: 120,492,273 F494L probably damaging Het
Tmem198 C A 1: 75,479,878 P89Q probably damaging Het
Tnks2 T G 19: 36,857,884 C2G probably damaging Het
Trappc9 T C 15: 72,801,353 E869G unknown Het
Trim42 T A 9: 97,369,531 K105M probably benign Het
Ttll3 T C 6: 113,392,674 S60P probably benign Het
Tubgcp5 T A 7: 55,829,433 probably null Het
Txlnb A T 10: 17,806,846 Y172F probably damaging Het
Ube2e3 A T 2: 78,913,691 D88V possibly damaging Het
Vmn1r189 T A 13: 22,102,260 I136L probably benign Het
Vmn2r71 A G 7: 85,618,742 I135V probably benign Het
Vmn2r73 T A 7: 85,869,865 R516S probably benign Het
Wrn C T 8: 33,240,978 E1352K probably benign Het
Zfp318 T C 17: 46,411,213 S1381P probably damaging Het
Zfp747 A T 7: 127,374,483 Y172N probably damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 splice site probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 splice site probably null
R2876:Ttll4 UTSW 1 74686438 splice site probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74688661 missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74687259 missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74679413 missense probably benign 0.00
R7837:Ttll4 UTSW 1 74681757 critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74696473 missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74679230 missense probably benign 0.02
R8115:Ttll4 UTSW 1 74687330 nonsense probably null
R8949:Ttll4 UTSW 1 74681816 missense probably damaging 0.99
R9145:Ttll4 UTSW 1 74679790 missense probably benign 0.02
R9156:Ttll4 UTSW 1 74680066 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTAGTGACCTATCTGCTCAGG -3'
(R):5'- TGGCTCTCAATTCTGGGCAG -3'

Sequencing Primer
(F):5'- CCTATCTGCTCAGGAAAGGGTG -3'
(R):5'- GCTGGATGAGCTCAGAGGACTTTC -3'
Posted On 2022-04-18