Incidental Mutation 'R9329:Ttll3'
ID 706714
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9329 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 113389260-113414587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113392674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 60 (S60P)
Ref Sequence ENSEMBL: ENSMUSP00000032414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000156898] [ENSMUST00000171058] [ENSMUST00000203578] [ENSMUST00000204026] [ENSMUST00000204802] [ENSMUST00000205017]
AlphaFold A4Q9E5
Predicted Effect probably benign
Transcript: ENSMUST00000032414
AA Change: S60P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: S60P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
AA Change: S60P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: S60P

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156898
SMART Domains Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 167 8.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171058
SMART Domains Protein: ENSMUSP00000131690
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 91 1.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203524
Predicted Effect probably benign
Transcript: ENSMUST00000203578
SMART Domains Protein: ENSMUSP00000145344
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204026
SMART Domains Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204802
SMART Domains Protein: ENSMUSP00000144751
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 77 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T G 6: 83,156,574 M1R probably null Het
4932415D10Rik G A 10: 82,285,605 S3857L probably benign Het
Acap2 T C 16: 31,127,420 D235G probably damaging Het
Adgrv1 C A 13: 81,499,122 V3100F probably damaging Het
Aff4 A G 11: 53,397,859 T401A probably damaging Het
Apcs T C 1: 172,894,824 T22A probably benign Het
Atf7ip2 T C 16: 10,241,874 V426A possibly damaging Het
Bach2 A G 4: 32,562,175 D214G possibly damaging Het
Baz2a C T 10: 128,125,056 A1578V possibly damaging Het
Camk1d T C 2: 5,445,143 I76V probably benign Het
Ccdc182 A T 11: 88,294,498 M135L probably benign Het
Cd47 C T 16: 49,896,368 T201I Het
Chodl T C 16: 78,949,142 S290P possibly damaging Het
Chst15 A G 7: 132,266,791 L300P possibly damaging Het
Ciita T C 16: 10,506,707 S168P probably damaging Het
Cntn2 C T 1: 132,528,940 V123I probably benign Het
Cyld T A 8: 88,730,720 L527Q probably benign Het
Dbn1 T A 13: 55,483,428 Y34F probably damaging Het
Enc1 C A 13: 97,246,510 Y509* probably null Het
Ermard A T 17: 15,053,381 E409D probably benign Het
Extl3 T C 14: 65,077,316 E139G possibly damaging Het
Fa2h A T 8: 111,355,483 V177E possibly damaging Het
Flot2 T C 11: 78,058,946 I367T probably damaging Het
Fras1 T C 5: 96,736,954 Y2564H probably damaging Het
Fxyd3 A G 7: 31,073,593 V10A probably benign Het
Gfra3 A G 18: 34,704,507 L146P probably damaging Het
Gm49359 T C 13: 62,454,634 N251D probably benign Het
Hps6 A G 19: 46,004,103 S160G probably benign Het
Hsd17b7 C A 1: 169,967,306 A55S probably damaging Het
Hspa12a T C 19: 58,800,866 D446G probably benign Het
Htt G A 5: 34,832,613 R1163Q possibly damaging Het
Ift81 T C 5: 122,559,770 probably null Het
Ighv5-15 T G 12: 113,826,775 Y75S probably benign Het
Kcnd2 T A 6: 21,725,982 H491Q probably damaging Het
Lamb3 C A 1: 193,332,357 T608K probably benign Het
Lrtm2 T A 6: 119,320,451 K210* probably null Het
Med13 G T 11: 86,298,457 P1209T probably benign Het
Mtus1 G A 8: 41,084,202 T159I probably damaging Het
Myt1l A G 12: 29,851,660 M805V unknown Het
Neb G T 2: 52,270,219 L2261I probably benign Het
Nlrp4c G A 7: 6,065,499 R133H probably benign Het
Nol11 A T 11: 107,180,939 L276Q probably damaging Het
Nrap A G 19: 56,361,845 Y614H probably damaging Het
Olfr271-ps1 G A 4: 52,936,211 T24M probably damaging Het
Olfr656 A G 7: 104,618,498 H273R probably damaging Het
Pou2f3 A G 9: 43,128,929 S355P probably damaging Het
Ppm1l C A 3: 69,553,120 N343K probably damaging Het
Prh1 A T 6: 132,571,610 I27F unknown Het
Prkrip1 A T 5: 136,194,349 L85Q probably damaging Het
Pycrl C T 15: 75,918,714 V99I probably benign Het
R3hdm4 T A 10: 79,913,559 N72I probably damaging Het
Rab11fip3 G T 17: 26,012,058 H738N probably benign Het
Rtl1 G A 12: 109,590,239 A1722V possibly damaging Het
Sell A G 1: 164,065,553 N113D probably damaging Het
Smarcal1 T C 1: 72,626,538 S732P probably damaging Het
Smurf2 A T 11: 106,852,598 D207E probably benign Het
Tat C T 8: 109,996,878 R333C probably benign Het
Tmem121b A T 6: 120,492,273 F494L probably damaging Het
Tmem198 C A 1: 75,479,878 P89Q probably damaging Het
Tnks2 T G 19: 36,857,884 C2G probably damaging Het
Trappc9 T C 15: 72,801,353 E869G unknown Het
Trim42 T A 9: 97,369,531 K105M probably benign Het
Ttll4 T A 1: 74,685,962 I625N possibly damaging Het
Tubgcp5 T A 7: 55,829,433 probably null Het
Txlnb A T 10: 17,806,846 Y172F probably damaging Het
Ube2e3 A T 2: 78,913,691 D88V possibly damaging Het
Vmn1r189 T A 13: 22,102,260 I136L probably benign Het
Vmn2r71 A G 7: 85,618,742 I135V probably benign Het
Vmn2r73 T A 7: 85,869,865 R516S probably benign Het
Wrn C T 8: 33,240,978 E1352K probably benign Het
Zfp318 T C 17: 46,411,213 S1381P probably damaging Het
Zfp747 A T 7: 127,374,483 Y172N probably damaging Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8344:Ttll3 UTSW 6 113394998 missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113412889 missense probably benign 0.00
R9036:Ttll3 UTSW 6 113399696 missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113392635 missense probably benign
R9271:Ttll3 UTSW 6 113392635 missense probably benign
R9532:Ttll3 UTSW 6 113409009 missense possibly damaging 0.69
R9535:Ttll3 UTSW 6 113412873 missense probably damaging 1.00
R9725:Ttll3 UTSW 6 113409153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTAGGAGACGGGAAAC -3'
(R):5'- TGCATTGCAGATTCCCCATC -3'

Sequencing Primer
(F):5'- CACTGCGAGCTGGCTAAAG -3'
(R):5'- ATCAGGAAGGGGCTCATCC -3'
Posted On 2022-04-18