Incidental Mutation 'R9329:Chst15'
ID 706725
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Name carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Synonyms MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9329 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 132235780-132317228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132266791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 300 (L300P)
Ref Sequence ENSEMBL: ENSMUSP00000076682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
AlphaFold Q91XQ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000077472
AA Change: L300P

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: L300P

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080215
AA Change: L300P

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: L300P

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T G 6: 83,156,574 M1R probably null Het
4932415D10Rik G A 10: 82,285,605 S3857L probably benign Het
Acap2 T C 16: 31,127,420 D235G probably damaging Het
Adgrv1 C A 13: 81,499,122 V3100F probably damaging Het
Aff4 A G 11: 53,397,859 T401A probably damaging Het
Apcs T C 1: 172,894,824 T22A probably benign Het
Atf7ip2 T C 16: 10,241,874 V426A possibly damaging Het
Bach2 A G 4: 32,562,175 D214G possibly damaging Het
Baz2a C T 10: 128,125,056 A1578V possibly damaging Het
Camk1d T C 2: 5,445,143 I76V probably benign Het
Ccdc182 A T 11: 88,294,498 M135L probably benign Het
Cd47 C T 16: 49,896,368 T201I Het
Chodl T C 16: 78,949,142 S290P possibly damaging Het
Ciita T C 16: 10,506,707 S168P probably damaging Het
Cntn2 C T 1: 132,528,940 V123I probably benign Het
Cyld T A 8: 88,730,720 L527Q probably benign Het
Dbn1 T A 13: 55,483,428 Y34F probably damaging Het
Enc1 C A 13: 97,246,510 Y509* probably null Het
Ermard A T 17: 15,053,381 E409D probably benign Het
Extl3 T C 14: 65,077,316 E139G possibly damaging Het
Fa2h A T 8: 111,355,483 V177E possibly damaging Het
Flot2 T C 11: 78,058,946 I367T probably damaging Het
Fras1 T C 5: 96,736,954 Y2564H probably damaging Het
Fxyd3 A G 7: 31,073,593 V10A probably benign Het
Gfra3 A G 18: 34,704,507 L146P probably damaging Het
Gm49359 T C 13: 62,454,634 N251D probably benign Het
Hps6 A G 19: 46,004,103 S160G probably benign Het
Hsd17b7 C A 1: 169,967,306 A55S probably damaging Het
Hspa12a T C 19: 58,800,866 D446G probably benign Het
Htt G A 5: 34,832,613 R1163Q possibly damaging Het
Ift81 T C 5: 122,559,770 probably null Het
Ighv5-15 T G 12: 113,826,775 Y75S probably benign Het
Kcnd2 T A 6: 21,725,982 H491Q probably damaging Het
Lamb3 C A 1: 193,332,357 T608K probably benign Het
Lrtm2 T A 6: 119,320,451 K210* probably null Het
Med13 G T 11: 86,298,457 P1209T probably benign Het
Mtus1 G A 8: 41,084,202 T159I probably damaging Het
Myt1l A G 12: 29,851,660 M805V unknown Het
Neb G T 2: 52,270,219 L2261I probably benign Het
Nlrp4c G A 7: 6,065,499 R133H probably benign Het
Nol11 A T 11: 107,180,939 L276Q probably damaging Het
Nrap A G 19: 56,361,845 Y614H probably damaging Het
Olfr656 A G 7: 104,618,498 H273R probably damaging Het
Pou2f3 A G 9: 43,128,929 S355P probably damaging Het
Ppm1l C A 3: 69,553,120 N343K probably damaging Het
Prh1 A T 6: 132,571,610 I27F unknown Het
Prkrip1 A T 5: 136,194,349 L85Q probably damaging Het
Pycrl C T 15: 75,918,714 V99I probably benign Het
R3hdm4 T A 10: 79,913,559 N72I probably damaging Het
Rab11fip3 G T 17: 26,012,058 H738N probably benign Het
Rtl1 G A 12: 109,590,239 A1722V possibly damaging Het
Sell A G 1: 164,065,553 N113D probably damaging Het
Smarcal1 T C 1: 72,626,538 S732P probably damaging Het
Smurf2 A T 11: 106,852,598 D207E probably benign Het
Tat C T 8: 109,996,878 R333C probably benign Het
Tmem121b A T 6: 120,492,273 F494L probably damaging Het
Tmem198 C A 1: 75,479,878 P89Q probably damaging Het
Tnks2 T G 19: 36,857,884 C2G probably damaging Het
Trappc9 T C 15: 72,801,353 E869G unknown Het
Trim42 T A 9: 97,369,531 K105M probably benign Het
Ttll3 T C 6: 113,392,674 S60P probably benign Het
Ttll4 T A 1: 74,685,962 I625N possibly damaging Het
Tubgcp5 T A 7: 55,829,433 probably null Het
Txlnb A T 10: 17,806,846 Y172F probably damaging Het
Ube2e3 A T 2: 78,913,691 D88V possibly damaging Het
Vmn1r189 T A 13: 22,102,260 I136L probably benign Het
Vmn2r71 A G 7: 85,618,742 I135V probably benign Het
Vmn2r73 T A 7: 85,869,865 R516S probably benign Het
Wrn C T 8: 33,240,978 E1352K probably benign Het
Zfp318 T C 17: 46,411,213 S1381P probably damaging Het
Zfp747 A T 7: 127,374,483 Y172N probably damaging Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5817:Chst15 UTSW 7 132269147 missense probably damaging 0.99
R5917:Chst15 UTSW 7 132270517 missense probably benign
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
R7911:Chst15 UTSW 7 132270522 missense probably benign 0.12
R8282:Chst15 UTSW 7 132270150 missense probably benign
R8342:Chst15 UTSW 7 132247886 missense probably benign 0.15
R9011:Chst15 UTSW 7 132270517 missense probably benign
R9093:Chst15 UTSW 7 132268917 critical splice donor site probably null
R9352:Chst15 UTSW 7 132270528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTCTGCTTCTGCCAGC -3'
(R):5'- ATGTACACGTTGAAGCAGGCAG -3'

Sequencing Primer
(F):5'- AGCTCCCCTGAAGGTACC -3'
(R):5'- GGCATTGACAGAGCTCTCCATC -3'
Posted On 2022-04-18